OUR TEAM
Alyssa Alexander Research & Development
|
| Sichun Ai protocols planner
| Malik Alnaim protocols planner
|
|
LAB 2 WRITE-UP
Thermal Cycler Engineering
Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
System Design
Key Features
Instructions
Protocols
Polymerase Chain Reaction
Polymerase chain reaction is basically molecular photocopying and the process or technique used to make copies of small segments of DNA because it only targets specific segments of the DNA and that's what makes it useful. PCR works by mixing two DNA fragments, also known as primers which are about 20 bases long. The mixture is then heated and denatured and then the primers bind to their complementary sequences on the separated strands. Then, the polymerase extends primers into new complementary strands and it goes through about 30 cycles. PCR products are useful and can be used in many experiments like DNA fingerprinting and detection of viruses.
- (Jim Dorsey) Polymerase Chain Reaction. http://www.contexo.info/DNA_Basics/polymerase_chain_reaction.htm. Last accessed 11/01/12.)
Materials
Supplied in Kit
| PCR Machine
| 1
|
| Instruction Manual
| 1
|
| Extra screws/bolts/nuts
| 5 each
|
| USB Cable
| 1
|
| Extra Battery
| 1
|
| Power Cord
| 1
|
Supplied by User
| Computer
| 1
|
| Smartphone with Camera
| 1
|
| Pipettes
| 12
|
| Eppendorf Tubes
| 8
|
| Distilled Water
| As much as needed
|
| SYBR Green I
| 5 mL
|
| Smartphone holder
| 1
|
| Fluorimeter
| 1
|
| Image J Software
| 1
|
| GoTaq Mastermix
| 1
|
| Glass slides
| As many as needed (1)
|
| Calf Thymus
| 50 μL
|
PCR Protocol
Steps to Amplify DNA Samples
- Collect three replicate DNA samples from two patients. (was provided already)
- The DNA samples are 50 μL each, get the patient's ID and label the the each tube.
- PCR reaction mix - Mix contains Taq DNA polymerase, MgCl2, dNTP's, forward primer, and reverse primer.
- The primers are artificial DNA, designed to match the chain of DNA we want.
- Taq polymerase is the enzyme that binds to the end of the new chain and recreates the separated DNA.
- Mgcl2 binds to Taq as a co-factor and helps Taq to function appropriately, and affects the speed of the Taq binding to the loose strands.
- dNTp's is dioxnucleotidetriphosphate. this is what is used to recreate the second DNA strands.
- The 8 tubes of mixtures will then go through the cycles in the PCR system.
- During each step of the thermal cycling, the DNA is unzipped and heated to 95°C to break the H-bonds between the 2 strands. This exposes the part we want in this lab experiment. Then, the primer binds to the trage we want without cancer marker, this primer won't bind. Next, the temperature will be dropped to 57°C in order to bind the primer. Later, it is heat it back up to 72°C with the Taq to reform and duplicate DNA strands. Finally, this thermal cycling is repeated for amplification and add dye that binds specifically to DNA for detection.
- Pippette 50 μL DNA sample into the labeled PCR tubes.
- Place the pipettes separately on the table to avoid contamination
- Use a pipette to add 50 μL of GoTaq Master mix to each of the PCR tubes, and discard the pipette after each tube.
- Create a new program on the Open PCR system (connected to the computer)
- Create three stages
- Stage 1: 1 cycle, 95°C for 3 minutes
- Stage 2: 30 cycles for 95°C for 30 seconds, 57°C for 30 seconds, 72°C for 30 seconds
- Stage 3. 72°C for 3 minutes
- Final hold: 4°C
- Save the Program
- Place PCR tubes inside the machine and push down on the lid to close it
- Finally, click the start button in the OpenPCR program and run the experiment.
The time for this experiment will be reduced due to the improvements made on the PCR machine. It should cycle much quicker than it did before (about an hour and a half to two hours). How much of a time difference is uncertain.
The Components of the GoTaq® Colorless Master Mix
"dNTP's, MgCl2, and reaction buffers at optimal concentration for efficient amplification of DN templates by PCR."
Volumes Used for Mixture
Table 1
| Reagent
| Volume
|
| Template DNA (20 ng)
| 10.2 μL
|
| 10 μM reverse primer
| 1.0 μL
|
| dH2O
| 47.8 μL
|
| 0 μM forward primer
| 1.0 μL
|
| GoTaq master mix
| 50.0 μL
|
| Total Volume
| 100.0 μL
|
DNA Samples (8)
Positive Control: Cancer DNA Template Tube label A | Replicate 1 Tube Label 1-1 Patient 1 ID: 27762, F, Age: 52 | Replicate 2 Tube Label 1-2 Patient 1 ID: 27762, F, Age: 52 | Replicate 1 Tube Label 1-3 Patient 3 ID: 27762, F, Age: 52
|
Negative Control: No DNA Template Tube Label B | Replicate 2 Tube Label 2-1 Patient 2 ID: 59484, F, Age: 45 | Replicate 2 Tube Label 2-2 Patient 2 ID: 59484, F, Age: 45 | Replicate 2 Tube Label 2-3 Patient 2 ID: 59484, F, Age: 45
|
DNA Measurement Protocol
- First, the glass side of the slide was placed faced down onto the device.
- A different pipette was used for transferring each content from the small tubes to the bigger ones.
- After labeling the tubes and pipettes, gloves were worn to ensure a contamination free procedure.
- Using the specific pipette for each component, one drop of buffer was put onto the first and second centered holes of the slide and two drops of diluted sample were placed on the gathered buffer drops.
- Turn on the light and adjust it so that it goes through the drop.
- The device was then put as far back inside the upside down box as possible so that much of the stray light will be removed.
- The phone was placed into the holder inside the box.
- After customizing the photo settings in the phone according to the instruction sheet, a shot of the drop sample was taken and saved.
- The number of the photo was recorded in a table to keep track of the photos.
- The photo was sent to the e-mail of the group member who was responsible for analyzing the photo.
- The previous steps were repeated for each sample with the exception of:
- Replacing the water drops with the rest of the samples.
- Using next two consecutive holes on the glass slide each time a sample was used.
Open ImageJ
1. By using a USB cable, connect the camera phone to the desired computer that has already ImageJ installed.
2. Under my computer, choose portable devices where you could find the smartphone listed; double-click on it.
3. After localizing the DCIM folder and opening it, you should select camera.
4. The desired photos can then be transferred by simply putting them into the created folder.
5. Open ImageJ and go to file; click on it and choose open.
6. Select browse then pick the desired picture from the same folder created earlier.
7. To continue opening different pictures, you should only repeat steps 5 and 6.
Research and Development
Background on Disease Markers
Parkinson’s Disease is a degenerative disorder in the nervous system where the nerve cells cannot send messages to the muscles adequately due to a lack of dopamine. This usually leads to tremors and a difficulty moving. Typically, Parkinson’s disease develops in person after the age of 50, but it is not always the case. This disease cannot be cured, but it can be treated.
This disease is generally contracted through genetics. The SNP of this is can be found in SNP cluster report of rs2853826. The error is due to an adenine nucleotide replaced with the guanine.
Source: http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=2853826
Primer Design
The reverse primer used: ATTAGACTGA-G-GGCTTAACCA
The forward primer used: TGGTTAAGCCCTCAGTCTAAT
Illustration
|