BME103:T130 Group 16 l2: Difference between revisions
Line 83: | Line 83: | ||
The changes we made to our PCR machine include the additions of a new lid with multiple heating blocks, rather than just one, and of a revolving mechanism which is capable of holding multiple PCR tubes at one time. Multiple heating blocks allows for faster cycles because they eliminate the time it takes to heat/cool a mere one block repeatedly in order to replicate the DNA. Now, the test DNA can be quickly moved to preheated blocks without the lag time. Also, multiple DNA samples may be replicated at one time depending on the block temperature set-up and positioning of the PCR tubes in the revolver. By this method, literally an infinite amount of DNA samples can be replicated all at once, depending on the size of the machine of course. But, as far as our innovated machine goes, up to three separate samples may be run within a 2-hour period. The volume of the reaction remains the same as it was in the old machine, and DNA measurement must be done separately via a fluorimeter.<br><br> | The changes we made to our PCR machine include the additions of a new lid with multiple heating blocks, rather than just one, and of a revolving mechanism which is capable of holding multiple PCR tubes at one time. Multiple heating blocks allows for faster cycles because they eliminate the time it takes to heat/cool a mere one block repeatedly in order to replicate the DNA. Now, the test DNA can be quickly moved to preheated blocks without the lag time. Also, multiple DNA samples may be replicated at one time depending on the block temperature set-up and positioning of the PCR tubes in the revolver. By this method, literally an infinite amount of DNA samples can be replicated all at once, depending on the size of the machine of course. But, as far as our innovated machine goes, up to three separate samples may be run within a 2-hour period. The volume of the reaction remains the same as it was in the old machine, and DNA measurement must be done separately via a fluorimeter.<br><br> | ||
'''Materials''':<br> | '''Materials''':<br> | ||
Mounting rectangular plate with circular cutouts <br>
| Mounting rectangular plate with circular cutouts<br>
| ||
3 heated silver discs<br> | 3 heated silver discs<br> | ||
3 white insulation covers<br> |
3 white insulation covers<br> |
Revision as of 13:52, 29 November 2012
BME 103 Fall 2012 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski. System Design
Instructions 1. Find the 3 heated silver discs and fit them into the mounting rectangular plate where the cutouts are.
ProtocolsThe changes we made to our PCR machine include the additions of a new lid with multiple heating blocks, rather than just one, and of a revolving mechanism which is capable of holding multiple PCR tubes at one time. Multiple heating blocks allows for faster cycles because they eliminate the time it takes to heat/cool a mere one block repeatedly in order to replicate the DNA. Now, the test DNA can be quickly moved to preheated blocks without the lag time. Also, multiple DNA samples may be replicated at one time depending on the block temperature set-up and positioning of the PCR tubes in the revolver. By this method, literally an infinite amount of DNA samples can be replicated all at once, depending on the size of the machine of course. But, as far as our innovated machine goes, up to three separate samples may be run within a 2-hour period. The volume of the reaction remains the same as it was in the old machine, and DNA measurement must be done separately via a fluorimeter.
Supplied by User
1. Create a new trial on the Open PCR program
3. Add PCR Master Mix (Extracted DNA, primers, Taq Polymerase) to PCR tube The components of the GoTaq Colorless Master Mix: dNTP;s, MgCl2, and reaction buffers
1. Prop up black box to block outside light pollution, but with one side open for access to take pictures Opening Image J Procedure: Research and DevelopmentBackground on Disease Markers One of the genes we examined is associated with Alzheimer's Disease, a progressive neurologic disease of the brain that is the most common type of Dementia. In patients diagnosed with Alzheimer's Disease, Plaques, deposits of protein fragment that build up between nerve cells, and Tangles, twisted fibers of protein that build up inside cells, both develop within the brain which kills brain cells. Alzheimer's patients also have a deficiency of Neurotransmitters which are involved in the transmission of messages in the brain. All of this leads to the irreversible loss of neurons in the brain, which over time leads to the loss of intellectual abilities, specifically memory and reasoning. As the disease progresses, the loss of these abilities hampers social and occupational functioning. Reference Number: rs63750973 Chromosome located on: 21 Gene ID: APP Allele Change: C → T Residue Change: T [Thr] → I[Ile] Gene Sequence: CATGGTGGGCGGTGTTGTCATAGCGA[C/T]AGTGATCGTCATCACCTTGGTGATG
Reference Number: rs78478128 Chromosome located on: X Gene ID: G6PD Allele Change: C → G Residue Change: A [Ala] → G [Gly] Gene Sequence: AGATGGTGGGGTAGATCTTCTTCTTG[C/G]CCAGGTCACCCTGTGGCAGAGGGAA
Forward Primer: 5' CATAGCGA[T]AGTGATCGTCA 3' Reverse Primer: 3' GTATCGCT[A]TCACTAGCAGT 5' Sickle Cell Anemia Gene Forward Primer: 5' TCTTCTTG[G]CCAGGTCACCC 3' Reverse Primer: 3' AGAAGAAC[C]GGTCCAGTGGG 5' A disease allele will produce a PCR product because the mutation in a disease carrying sample would make the proper sequence to bind to the primer, whereas a non-disease allele that does not possess the specific mutated base (the C→T mutated base for the Alzheimer's gene and the C→G mutated base for the Sickle Cell gene) would not have the correct sequence to bind to the primer. The primers are also within the ideal 18-22 bp length and abide by the GC Clamp rule, proving that all of the primers would be effective.
|