BME103:T130 Group 1 l2

BME 103 Fall 2012	Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help
OUR TEAM Name: Tianzhu Zhu Experimental protocol planner Name: Wyatt Hansen Open PCR machine engineer Name: Bryce Hicok Open PCR machine engineer Name: Jesus Ibarra Experimental protocol planner Name: Emma Maiorella R&D scientist LAB 2 WRITE-UP Thermal Cycler Engineering Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski. System Design All wood structures will be replaced with a high density plastic material. The screws will be replaced with snap on hinges. Key Features Instructions Protocols Materials Supplied in the Kit Amount PCR Machine 1X Sybr Green Buffer 1μL (Can be diluted up to 10,000 times) Regular Buffer (Magnesium Chloride) 1μL (Can be diluted up to 10,000 times) 4 bases 25μL Primers 25μL Micropipets 4X ImageJ Installation Disc 1X DNA Polymerase 5,000 units/mL Supplied by User Amount DNA samples 1 pipet droplet PCR Protocol DNA Measurement Protocol Research and Development Background on Disease Markers The disease marker being used is SNP rs35685286. This is the marker for sickle-cell disease found on chromosome 11. Patients with sickle-cell disease have red blood cells that are mishapen and are a "sickled" or crescent shape. This results in less oxygen being carried to the patient's body tissues. Therefore, patients experience crisis, where they have severe pain in their bones in their backs or chest. These symptoms can last for hours or even days. More information about this particular SNP can be found at: http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=35685286 Primer Design The forward primer for this disease is ACTCCGGACCCGTCCAACCAT and the reverse primer for a patient without sickle-cell disease would be TGAGGCCTGGGCAGGGTTGGTA. If a patient were to be positive for sickle-cell disease, Illustration