Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
System Design
All wood structures will be replaced with a high density plastic material. The screws will be replaced with snap on hinges.
Key Features
The key features of change we are focusing on is the casing and how it is assembled/dissembled. Our design changes are to use high density plastic instead of the wood casing currently used. We would also change from using screws to using a snap on feature. These simple changes will create major improvements in the PCR system. Using high density plastic will make it easy to see inside and to know when the heating lid is in proper place. It was also secure the safety issues of the wood being flammable. Then change from using screws to a snap on feature will make it easy and quick to assemble and disassemble. Before when using screws, it was stressful with dropping screws within the PCR causing you to have to start over with the assembly. With a snap on feature, the casing will simply snap on and off making the assembly quick and easy with no need of tools like a screwdriver.
Instructions
Place the plastic base of the PCR on a flat surface
Attach the back panel of the casing via interlocking hinges
Attach both the left and right sides to the back panel as well as the base
Snap the lid components onto the top of the PCR so that the there is only one face of the structure still open
insert internal devices in their appropriate places
Snap the front panel onto the 3 sides of the PCR to complete the external shell of the PCR
Protocols
Materials
Supplied in the Kit
Amount
PCR Machine
1X
Sybr Green Buffer
1μL (Can be diluted up to 10,000 times)
Regular Buffer (Magnesium Chloride)
1μL (Can be diluted up to 10,000 times)
4 bases
25μL
Primers
25μL
Micropipets
4X
ImageJ Installation Disc
1X
DNA Polymerase
5,000 units/mL
Supplied by User
Amount
DNA samples
1 pipet droplet
PCR Protocol
DNA Measurement Protocol
Research and Development
Background on Disease Markers
The disease marker being used is SNP (single nucleotide polymorphism) rs35685286. This is the marker for sickle-cell disease found on chromosome 11. Patients with sickle-cell disease have red blood cells that are mishapen and are a "sickled" or crescent shape. This results in less oxygen being carried to the patient's body tissues. Therefore, patients experience crisis, where they have severe pain in their bones in their backs or chest. These symptoms can last for hours or even days.
The forward primer for this disease is ACTCCGGACCCGTCCAACCAT and the reverse primer for a patient without sickle-cell disease would be TGAGGCCTGGGCAGGGTTGGTA. If a patient were to be positive for sickle-cell disease, their reverse primer would be TGAGGCCTGGACAGGTTGGTA. Therefore, a patient with this disease experiences the gene mutation from G binding to C to G binding to A. A positive test will be recognizable because while the DNA is replicating during the PCR process, the reverse primers will only attach to the diseased patient's DNA. Consequently, when the reaction is complete and the SYBR green is added, the diseased patient's DNA will appear to glow green. If a patient does not have the disease, their DNA will be present in single strands and will appear clear when injected with SYBR green.
Illustration
Step A shows the PCR heating up to 95 degrees Celcius so the hydrogen bonds between the base pairs of the double stranded DNA can be melted and separated. Next in step B, the machine is cooled to 50 degrees Celcius where the reverse primers come in and attach to the single DNA strands to create two new double stranded DNA. Finally in step C, the PCR machine is heated up to 72 degrees Celcius and the strands are fully replicated and the process repeats for approximately 30 cycles.