BME103:T130 Group 1 l2

From OpenWetWare

Revision as of 21:35, 15 November 2012 by Emma Maiorella (Talk | contribs)
Jump to: navigation, search
BME 103 Fall 2012 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help
Image:BME494_Asu_logo.png

Contents

OUR TEAM

Name: Tianzhu ZhuExperimental protocol planner
Name: Tianzhu Zhu
Experimental protocol planner
Name: Wyatt HansenOpen PCR machine engineer
Name: Wyatt Hansen
Open PCR machine engineer
Name: Bryce HicokOpen PCR machine engineer
Name: Bryce Hicok
Open PCR machine engineer
Name: Jesus IbarraExperimental protocol planner
Name: Jesus Ibarra
Experimental protocol planner
Name: Emma MaiorellaR&D scientist
Name: Emma Maiorella
R&D scientist

LAB 2 WRITE-UP

Thermal Cycler Engineering

Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.


System Design


All wood structures will be replaced with a high density plastic material. The screws will be replaced with snap on hinges.


Key Features


Instructions





Protocols

Materials

Supplied in the Kit Amount
PCR Machine 1X
Sybr Green Buffer 1μL (Can be diluted up to 10,000 times)
Regular Buffer (Magnesium Chloride) 1μL (Can be diluted up to 10,000 times)
4 bases 25μL
Primers 25μL
Micropipets 4X
ImageJ Installation Disc 1X
DNA Polymerase 5,000 units/mL


Supplied by User Amount
DNA samples 1 pipet droplet



PCR Protocol



DNA Measurement Protocol

Research and Development

Background on Disease Markers

The disease marker being used is SNP rs35685286. This is the marker for sickle-cell disease found on chromosome 11. Patients with sickle-cell disease have red blood cells that are mishapen and are a "sickled" or crescent shape. This results in less oxygen being carried to the patient's body tissues. Therefore, patients experience crisis, where they have severe pain in their bones in their backs or chest. These symptoms can last for hours or even days.

More information about this particular SNP can be found at: http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=35685286



Primer Design


The forward primer for this disease is ACTCCGGACCCGTCCAACCAT and the reverse primer for a patient without sickle-cell disease would be TGAGGCCTGGGCAGGGTTGGTA. If a patient were to be positive for sickle-cell disease, their reverse primer would be TGAGGCCTGGACAGGTTGGTA



Illustration


Personal tools