BME103:T130 Group 2

BME 103 Fall 2012	Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help
OUR TEAM Name: Alexandra Brunelle Research and Development Specialist Name: Charul Singh Experimental Protocol Planner Name: Alex Hoffmann Experimental Protocol Planner Name: AJ Ciferno Open PCR Machine Engineer Name: Haley Gjertsen Research and Development Specialist Name: student Role(s) LAB 1 WRITE-UP Initial Machine Testing The Original Design Experimenting With the Connections When we unplugged the LCD screen from the PCR machine, the machine's display screen stopped working, but information continued to transmit to the computer. When we unplugged the white wire that connects the Thermocouple to the 16-tube PCR block, the machine's temperature measurement was disabled/no longer kept track of heat readings. Test Run (October 18th, 20th): Responded normally, no signs of malfunction Protocols Polymerase Chain Reaction Reagent Volume Template DNA (20 ng) 0.2 µL 10 µM forward primer 1.0 µL 10 µM reverse primer 1.0 µL GoTaq master mix 50.0 µL dH20 47.8µL Total Volume 100.0 µL Sample Descriptions Sample 1: Positive Control (contains cancer DNA template), Tube label: P Sample 2: Negative Control (no DNA template), Tube label: N Patient 1 ID 74013, Male, Age 55 Sample 3: Patient 74013, Replicate 1. Tube label M1 Sample 4: Patient 74013, Replicate 2. Tube label M2 Sample 5: Patient 74013, Replicate 3. Tube label M3 Patient 2 ID: 72825, Female, Age 55 Sample 6: Patient 72825, Replicate 1. Tube label F1 Sample 7: Patient 72825, Replicate 2, Tube label F2 Sample 8: Patient 72825, Replicate 3, Tube label F3 Flourimeter Measurements (Add your work from Week 3, Part 2 here) Research and Development Specific Cancer Marker Detection - The Underlying Technology PCR stands for Polymerase Chain Reaction PCR is used to amplify a specific segment of DNA that codes for cancer. Some basic components involved in a PCR reaction are: Template DNA: the original strand of DNA that is going to be copied Primers: attach to the sites on the DNA strands that are at either end of the template DNA, they drive the PCR(if they are able to attach the patient is negative for cancer Taq Polymerase: reads the DNA code and matches new nucleotides with the template strand, bind the pairs together with hydrogen bonds (example: A-T, C-G) Magnesium Chloride: a three atom molecule that binds to Taq polymerase as a cofactor to help it function properly dNTP's: deoxinucleotide triphosphate, they are the new nucleotides A PCR functions by going through a series of thermal cycles: In the first cycle the PCR machine heats up to 95 degrees Celsius. This unzips the DNA strand creating two separate DNA strand molecules and exposes the nucleotides we wish to look at. In the second cycle the temperature drops to 57 degrees Celsius which allows the primase to bind to the ends of the DNA strands. The third cycle heats up the DNA to 72 degrees Celsius to allow DNA replication by the enzyme Taq polymerase. These three cycles are repeated many more times in order for us to obtain we need to see if the patient tests positive for cancer. r17879961 The single nucleotide polymorphism, or SNP, when coding for cancer is AACTCTTACACTCGATACAT whereas in a normal patient the C is replaced with T. The reason the C would cause cancer in a patient is because there is an improper base pair occurring causing the primers not to bind resulting in single strands forming (C does does not code with A). After the PCR's thermal cycles are finished the cancerous patient's DNA will be single stranded and we will be able to see this after fluorescent dye is added and nothing appears. The fluorescent dye only shows the double stranded non cancerous patients. (BONUS points: Use a program like Powerpoint, Word, Illustrator, Microsoft Paint, etc. to illustrate how primers bind to the cancer DNA template, and how Taq polymerases amplify the DNA. Screen-captures from the OpenPCR tutorial might be useful. Be sure to credit the source if you borrow images.) Results (Your group will add the results of your Fluorimeter measurements from Week 4 here)