OUR TEAM
Name: Alexandra Brunelle Research and Development Specialist
| Name: Charul Singh Experimental Protocol Planner
| Name: Alex Hoffmann Experimental Protocol Planner
| Name: AJ Ciferno Open PCR Machine Engineer
| Name: Haley Gjertsen Research and Development Specialist
|
|
LAB 1 WRITE-UP
Initial Machine Testing
The Original Design

The Polymerase Chain Reaction (PCR) machine is used to test for variations in nucleotides. It is simple, easy to use, and portable. For our purposes we used the PCR machine to test for cancer in patients. It was able to test up to sixteen test tubes at a time and took slightly more than an hour and a half to complete the cycles. It heats up in order to separate the DNA strand and then cools to allow primers to attach and new replicated strands to form. It then heats back up to repeat the same cycles.
Experimenting With the Connections
When we unplugged the LCD screen from the PCR machine, the machine's display screen stopped working, but information continued to transmit to the computer.
When we unplugged the white wire that connects the Thermocouple to the 16-tube PCR block, the machine's temperature measurement was disabled, in other words, it no longer kept track of heat readings.
Test Run
On October 18th and 20th the PCR machine responded normally with no signs of malfunction. However, it took a little bit longer to complete the cycle; specifically, it took an hour and forty minutes in total. The machine LED display matched the computer screen which was a sign of success and proper function.
Protocols
Polymerase Chain Reaction
| Reagent | Volume
|
| Template DNA (20 ng) | 0.2 µL
|
| 10 µM forward primer | 1.0 µL
|
| 10 µM reverse primer | 1.0 µL
|
| GoTaq master mix | 50.0 µL
|
| dH20 | 47.8µL
|
| Total Volume | 100.0 µL
|
Sample Descriptions
Sample 1: Positive Control (contains cancer DNA template), Tube label: P
Sample 2: Negative Control (no DNA template), Tube label: N
Patient 1 ID 74013, Male, Age 55
Sample 3: Patient 74013, Replicate 1. Tube label M1
Sample 4: Patient 74013, Replicate 2. Tube label M2
Sample 5: Patient 74013, Replicate 3. Tube label M3
Patient 2 ID: 72825, Female, Age 55
Sample 6: Patient 72825, Replicate 1. Tube label F1
Sample 7: Patient 72825, Replicate 2, Tube label F2
Sample 8: Patient 72825, Replicate 3, Tube label F3
Set up PCR Proceedures:
1. Label each tube differently and record label.
2. Insert reactants into their respective PCR tubes.
3. Connect assembled PCR machine to a computer.
4. Customize settings in program to two stages:
Stage 1: 1 cycle, heat to 95 degrees Celsius for 3 minutes
Stage 2: 35 cycles, heat to 95 degrees Celsius for 30 seconds; cool to 57 degrees Celsius for 30 seconds
Stage 3: heat to 72 degrees Celsius for 30 seconds.
5. Start up the OpenPCR program previously installed on the computer.
6. Place tubes in slots in PCR machine, and close lid tightly.
7. Lower the top of the lid until it just touches tops of tubes.
8. Press "Start" to run the PCR machine.
9. Record data.
Using a Fluorimeter

1. Smart Phone Stand
2. Smart Phone
3. Glass Slide and Blue Light Holder
4. Box
Fluorimeter Assembly Procedures:
1. Adjust the settings on the smart phone: no flash, contrast on the lowest setting, saturation on the highest setting and exposure on the highest setting
2. Place the slide (glass facing down) onto the device.
3. Using the pipette for SYBR Green Flourescent Dye, place two drops of the dye onto the center line two dots.
4. Now, using a pipette that corresponds to a specific solution, place two drops of the given solution on top of the SYBR Green drops.
5. Switch on the blue light and adjust slide to allow the light to shine through the solution drops.
6. Place the phone in the holder facing the device. (should be about two inches away)
7. Cover the device and the phone and holder with the black box to keep out light.
8. Take picture. For best results, set a timer on the phone to be able to close the box and maximize darkness.
9. Using the pipette marked for waste, remove the drops from the slide.
10. Repeat steps 3 through 8 for all samples, each time moving down the slide. You can conduct five tests per slide; in other words you will need two slides total.
ImageJ Set Up Procedures:
1. Download ImageJ onto a laptop using the ImageJ disk.
2. Save desired photos to desk top.
3. Open ImageJ
4. On the menu, select ANALYZE, and then select SET MEASUREMENTS. Now choose Area, Integrated Density, and Mean Grey Value.
5. Now you can upload photo to ImageJ
6. In order to analyze the pictures, you need to make the menu selection IMAGE. Now select COLOR. Finally, choose SPLIT CHANNELS. This will bring up three windows labeled blue, green, and red. Since SYBR green dye is green, you will want to analyze the photos under the window marked Green. Close the windows marked Red and Blue.
7. Now, using the oval tool, draw an oval around the drop and select ANALYZE and then select MEASURE. Write down the data given by ImageJ.
8. Using your laptops arrow keys, move the oval to a dark area in the picture to get data for the "noise." Again, select ANALYZE and then select MEASURE. Write down the data given by ImageJ.
9. Repeat steps 5 through 8 for all of the images.
Research and Development
Specific Cancer Marker Detection - The Underlying Technology
PCR stands for Polymerase Chain Reaction. This reaction is used to amplify a specific segment of DNA that codes for cancer.
Some basic components involved in a PCR reaction are:
Template DNA: This DNA template is the original strand of DNA that is going to be copied
Primers: These primers attach to the sites on the DNA strands that are at either end of the template DNA. They drive the PCR because they are powerful enzymes that allow replication to occur. In this reaction, if primers are able to attach to the DNA strand, the patient is negative for cancer.
Taq Polymerase: Tag Polymerase reads the DNA code and matches new nucleotides with the template strand. It bind the pairs together with hydrogen bonds, for example A's are bonded to T's and C's are bonded to G's. These base pairs make it possible to make several copies of the DNA strands.
Magnesium Chloride: Magnesium Chloride is a three atom molecule that binds to Taq Polymerase as a co-factor to help Tag Polymerase it function properly.
dNTP's: Deoxinucleotide Triphosphates are the new nucleotides
A PCR functions by going through a series of thermal cycles:
In the first cycle, the PCR machine heats up to 95 degrees Celsius. This unzips the DNA strand creating two separate DNA strand molecules and exposes the nucleotides that we wish to look at. In the second cycle, the temperature drops to 57 degrees Celsius which allows the primers to bind to the ends of the DNA strands. The third cycle heats up the DNA to 72 degrees Celsius to allow DNA replication by the enzyme Taq Polymerase. These three cycles are repeated many more times, allowing for billions of DNA copies to be made. We need multiple copies of the DNA so that we can see if the patient tests positive for cancer.
r17879961
The single nucleotide polymorphism, or SNP, that codes for cancer is AACTCTTACACTCGATACAT; in a normal patient, the C is replaced with T(AACTCTTACATTCGATACAT). The backwards part to these two sequences is TTGAGAATGTAAGCTATAGTA. The reason the C causes cancer in a patient is because there is an improper base pair causing the primers not to bind. This results in the formation of single strands. Keep in mind that C does not code wit A, it only codes with C. After the PCR's thermal cycles are finished the cancerous patient's DNA will be single stranded and we will be able to see this after SYBR green dye is added and the sample appears green. The SYBR green dye does not express the double stranded DNA, non-cancerous patients.
Reliability: Bayes Rule:
We saw that the SNP is two hundred base pairs away. This means that every two hundred base pairs the missense mutation is present.
Bayes' Theorem demonstrates the ratio of patients with true positive and negative results to patients with false positive and negative results. It takes into account several factions of the tested population. Because of the numerous false positive and negative results, this test is not feasible for widespread usage.
Bayes Theorem is represented by the equation: p(CIT)=[p(TIC)*p(C)]/[(p(TIC)*p(C))+(p(TI~C)*p(~C))]
In our case, the variables are assigned as follows:
C= cancer present
T= positive test
p(C)= Prior Probability
p(TIC)= Conditional Probability
p(TI~C)= Conditional Probability
p(~C)= Prior Probability
p(CIT)= Posterior Probability
We know that:
p(C)= 0.01
p(TIC)= 0.8
p(TI~C)= 0.096
p(~C)= 0.99
Therefore,
p(CIT)= 0.078 or 7.8%
Bonus!!
Below is a visual representation of what happens during a Polymerase Chain Reaction:
1. The DNA is heated up to 95 degrees Celsius, splitting the strand apart.

2.The solution is cooled down to 50 degrees Celsius and primers are able to attach to the separated strands.

3.The solution is heated to 72 degrees Celsius and taq Polymerase attaches.

4. The DNA strands are replicated at 72 degrees Celsius.

5. The process repeats as the PCR machine heats up to 95 degrees.
(Photo Credit: The images used here were borrowed from OpenPCR.)
Results
DNA Concentration Based on INTDEN
| Description | INTDEN w/ background subtracted | DNA Concentration, microg/ml
|
| Water Blank | 525630 | 0
|
| DNA Calf Thymus, 2microg/ml | 2372315 | 2
|
| P | 2121336 | 1.788410055
|
| M1 | -57048 | -.048094793
|
| M2 | 1436979 | 1.211457163
|
| M3 | 2803635 | 2.363627933
|
| N | 76818 | .064762057
|
| F1 | 140996 | .118867857
|
| F2 | 74969 | .063203242
|
| F3 | 2880430 | 2.4283706
|
| Sample | Integrated Density | DNA μg/mL | Conclusion
|
| PCR: Negative Control | 76818 | .064762057 | Negative
|
| PCR: Positive Control | 2121336 | 1.788410055 | Positive
|
| PCR: Patient 1 ID 74013, rep 1 | -57048 | -.048094793 | Negative
|
| PCR: Patient 1 ID 74013, rep 2 | 1436979 | 1.211457163 | Positive
|
| PCR: Patient 1 ID 74013, rep 3 | 2803635 | 2.363627933 | Positive
|
| PCR: Patient 2 ID 72825, rep 1 | 140996 | .118867857 | Negative
|
| PCR: Patient 2 ID 72825, rep 2 | 74969 | .063203242 | Negative
|
| PCR: Patient 2 ID 72825, rep 3 | 2880430 | 2.4283706 | Positive
|
KEY
- Sample = The sample is the DNA taken from the patient in a tube.
- Integrated Density = Integrated Density is an extensive quantity. It is the sum of the values of the pixels in the image or in the selected part of the image. This sum is the same as the product of the mean gray value and the area.
Integrated density(Background)-Integrated density(sample)=our data
- DNA μg/mL = This was calculated by multiplying the integrated density by two and dividing it by the integrated density of the calf thymus.
- Conclusion = A positive signal allowed the sample to appear green. No signal resulted in the sample appearing clear.

Cancerous Drop

Non Cancerous Drop
|