BME103:T130 Group 3: Difference between revisions
Line 97: | Line 97: | ||
2. 57°C – Primers attach at desired sequence <br> | 2. 57°C – Primers attach at desired sequence <br> | ||
3. 72°C – Polymerase extends DNA strand by attaching correct nucleotides in order. <Br> | 3. 72°C – Polymerase extends DNA strand by attaching correct nucleotides in order. <Br> | ||
4. Florescent dye is added and binds to double stranded DNA to detect strands. <br> | 4. Florescent dye is added and then binds to double stranded DNA to detect strands. <br> | ||
Why does a cancer gene produce a positive result and a non-cancer gene gives a negative result? <br> | Why does a cancer gene produce a positive result and a non-cancer gene gives a negative result? <br> |
Revision as of 15:33, 14 November 2012
BME 103 Fall 2012 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 1 WRITE-UPInitial Machine TestingThe Original Design
Experimenting With the Connections
Test Run (Write the date you first tested Open PCR and your experience(s) with the machine)
ProtocolsPolymerase Chain Reaction
Patient 2
(Add your work from Week 3, Part 2 here)
Research and DevelopmentSpecific Cancer Marker Detection - The Underlying Technology (Add a write-up of the information discussed in Week 3's class) Processes of Thermal Cycling: 1. 95°C – DNA is unzipped Why does a cancer gene produce a positive result and a non-cancer gene gives a negative result? Baye’s Rule is then used to allow understanding of the limitations of the tests.
Primer: AACTCTTACACTCGATACAT
ResultsPositive Test---------------------------------A1---------------------------------A2---------------------------------A3--------------------------------A4---------------- B1--------------------------------------------B2---------------------------------B3---------------------------------B4--------------------------------H2O----------------
|