BME103:T130 Group 3: Difference between revisions
Line 117: | Line 117: | ||
(Your group will add the results of your Fluorimeter measurements from Week 4 here) | (Your group will add the results of your Fluorimeter measurements from Week 4 here) | ||
[[Image:Positivetest.jpg]] | |||
[[Image:A1.jpg]] | |||
[[Image:A2.jpg]] | |||
[[Image:A3.jpg]] | |||
[[Image:A4.jpg]] | |||
[[Image:B1.jpg]] | |||
[[Image:B2.jpeg]] | |||
[[Image:B3.jpeg]] | |||
[[Image:B4.jpeg]] | |||
[[Image:H2O.jpg]] | |||
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | <!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | ||
|} | |} |
Revision as of 15:36, 8 November 2012
BME 103 Fall 2012 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | ||||||||||||||||||||
OUR TEAMLAB 1 WRITE-UPInitial Machine TestingThe Original Design
Experimenting With the Connections
Test Run (Write the date you first tested Open PCR and your experience(s) with the machine)
ProtocolsPolymerase Chain Reaction
Patient 2
(Add your work from Week 3, Part 2 here)
Research and DevelopmentSpecific Cancer Marker Detection - The Underlying Technology (Add a write-up of the information discussed in Week 3's class) Processes of thermal cycling: 1. 95 degrees – DNA is unzipped Why does a cancer gene produce a positive result and a non-cancer gene gives a negative result? Baye’s Rule is used to allow understanding of the limitations of the tests.
Primer: AACTCTTACACTCGATACAT
Results(Your group will add the results of your Fluorimeter measurements from Week 4 here)
|