BME103:T130 Group 3: Difference between revisions
Line 111: | Line 111: | ||
<b>Reliability (Baye's Rule) </b><br> | <b>Reliability (Baye's Rule) </b><br> | ||
Explanation:<br>Baye’s Rule analyzes all available data and allows us to understand the limitations of our diagnostic tests. It shows the relationship between conditional probability and its reverse form. | Explanation:<br>Baye’s Rule analyzes all available data and allows us to understand the limitations of our diagnostic tests. It shows the relationship between conditional probability and its reverse form. Baye’s reasoning can be applied to find the probability of true positives in relation to false positives and false negatives. This allows us to understand how reliable PCR is in detecting cancer sequences in patients. | ||
Equation:<br>[[Image:Bayes-rule.png|200px|]] | Equation:<br>[[Image:Bayes-rule.png|200px|]] | ||
C=cancer present<br> T=positive test<br> | |||
P(A|B)=probability of A, given B<br> ~=not | |||
Proportion of cancer patients with positive results, within the group of ALL patients with positive results:<br> | |||
A/(A+C)<br> | |||
=80/(80+950)<br> | |||
=80/1030 <br> | |||
=.078 <br> | |||
=7.8% <br> | |||
(BONUS points: Use a program like Powerpoint, Word, Illustrator, Microsoft Paint, etc. to illustrate how primers bind to the cancer DNA template, and how Taq polymerases amplify the DNA. Screen-captures from the OpenPCR tutorial might be useful. Be sure to credit the source if you borrow images.) | (BONUS points: Use a program like Powerpoint, Word, Illustrator, Microsoft Paint, etc. to illustrate how primers bind to the cancer DNA template, and how Taq polymerases amplify the DNA. Screen-captures from the OpenPCR tutorial might be useful. Be sure to credit the source if you borrow images.) |
Revision as of 19:03, 14 November 2012
BME 103 Fall 2012 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 1 WRITE-UPInitial Machine Testing
A Polymerase Chain Reaction (PCR) Machine (shown in the above image) is used to create large quantities of specific DNA sequences. This process consists of various heating and cooling cycles to unzip DNA strands and isolate the wanted DNA strands. Experimenting With the Connections When the Liquid Crystal Display (LCD) screen is disconnected from the open PCR circuit board, the LCD screen is shut off. The circuit board provides the power and input signals for the LCD screen, therefore, when the two parts are not connected the LCD screen will not function. When the 16-tube PCR block is disconnected from the PCR circuit board the block will not heat or cool. The fan and lid heater are both connected to the PCR circuit board with wires, so if this connection is disrupted, those parts will not function. Test Run (Write the date you first tested Open PCR and your experience(s) with the machine)
ProtocolsPolymerase Chain Reaction
Patient 2
(Add your work from Week 3, Part 2 here)
Research and DevelopmentSpecific Cancer Marker Detection - The Underlying Technology (Add a write-up of the information discussed in Week 3's class) Processes of Thermal Cycling: 1.) 95°C – DNA is unzipped Why does a cancer gene produce a positive result and a non-cancer gene gives a negative result? Baye’s Rule is then used to allow understanding of the limitations of the tests.
Primer: AACTCTTACACTCGATACAT
Reliability (Baye's Rule) C=cancer present Proportion of cancer patients with positive results, within the group of ALL patients with positive results:
ResultsPositive Test---------------------------------A1---------------------------------A2---------------------------------A3--------------------------------A4---------------- B1--------------------------------------------B2---------------------------------B3---------------------------------B4--------------------------------H2O----------------
|