A Polymerase Chain Reaction (PCR) Machine (shown in the above image) is used to create large quantities of specific DNA sequences. This process consists of various heating and cooling cycles to unzip DNA strands and isolate the wanted DNA strands.
Experimenting With the Connections
When the LCD screen is disconnected from the open PCR circuit board, the LCD screen is shut off. The circuit board provides the power and input signals for the LCD screen, therefore, when the two parts are not connected the LCD screen will not function. When the 16-tube PCR block is disconnected from the PCR circuit board the block will not heat or cool. The fan and lid heater are both connected to the PCR circuit board with wires, so if this connection is disrupted, those parts will not function.
Test Run
(Write the date you first tested Open PCR and your experience(s) with the machine)
Protocols
Polymerase Chain Reaction
The DNA samples were heated to ninety-five degrees Celsius (95°C) for three (3) minutes to unzip the two single strands. They were then cooled to fifty-seven degrees Celsius (57°C) and the primers were attached to their matching sequences. They were then heated back to seventy-two degrees Celsius (72°C) and polymerase extended the DNA strands by attaching the correct free nucleotides in order on the single strands.
Reagent
Volume
Template DNA (20 ng)
0.1μL
10μM forward primer
0.5μL
10μM reverse primer
0.5μL
GoTaq master mix
25.0μL
dH2O
23.9μL
Total Volume
50.0μL
Patient 1
ID 30269
Male, 55 years old
Patient 2
ID 22057
Female, 55 years old
Flourimeter Measurements
(Add your work from Week 3, Part 2 here)
Research and Development
Specific Cancer Marker Detection - The Underlying Technology
(Add a write-up of the information discussed in Week 3's class)
Processes of Thermal Cycling:
1. 95°C – DNA is unzipped
2. 57°C – Primers attach at desired sequence
3. 72°C – Polymerase extends DNA strand by attaching correct nucleotides in order.
4. Florescent dye is added and binds to double stranded DNA to detect strands.
Why does a cancer gene produce a positive result and a non-cancer gene gives a negative result?
The cancer gene contains the marker matched with the primer. The non-cancer gene does not contain the marker so therefore the primer does not attach and replication does not occur.
Baye’s Rule is then used to allow understanding of the limitations of the tests.
Primer: AACTCTTACACTCGATACAT
(BONUS points: Use a program like Powerpoint, Word, Illustrator, Microsoft Paint, etc. to illustrate how primers bind to the cancer DNA template, and how Taq polymerases amplify the DNA. Screen-captures from the OpenPCR tutorial might be useful. Be sure to credit the source if you borrow images.)