BME103:T130 Group 3
BME 103 Fall 2012 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 1 WRITE-UPInitial Machine Testing
A Polymerase Chain Reaction (PCR) Machine (shown in the above image) is used to create large quantities of specific DNA sequences. This process consists of various heating and cooling cycles to unzip DNA strands and isolate the wanted DNA strands. Experimenting With the Connections When the Liquid Crystal Display (LCD) screen is disconnected from the open PCR circuit board, the LCD screen is shut off. The circuit board provides the power and input signals for the LCD screen, therefore, when the two parts are not connected the LCD screen will not function. When the 16-tube PCR block is disconnected from the PCR circuit board the block will not heat or cool. The fan and lid heater are both connected to the PCR circuit board with wires, so if this connection is disrupted, those parts will not function. Test Run (Write the date you first tested Open PCR and your experience(s) with the machine)
ProtocolsPolymerase Chain Reaction
Patient 2
(Add your work from Week 3, Part 2 here)
Research and DevelopmentSpecific Cancer Marker Detection - The Underlying Technology (Add a write-up of the information discussed in Week 3's class) Processes of Thermal Cycling: 1.) 95°C – DNA is unzipped Why does a cancer gene produce a positive result and a non-cancer gene gives a negative result? Baye’s Rule is then used to allow understanding of the limitations of the tests.
Primer: AACTCTTACACTCGATACAT
Reliability (Baye's Rule) (BONUS points: Use a program like Powerpoint, Word, Illustrator, Microsoft Paint, etc. to illustrate how primers bind to the cancer DNA template, and how Taq polymerases amplify the DNA. Screen-captures from the OpenPCR tutorial might be useful. Be sure to credit the source if you borrow images.)
ResultsPositive Test---------------------------------A1---------------------------------A2---------------------------------A3--------------------------------A4---------------- B1--------------------------------------------B2---------------------------------B3---------------------------------B4--------------------------------H2O----------------
|