BME103:T130 Group 3 l2: Difference between revisions
Line 123: | Line 123: | ||
<!--- A description of the diseases and their associated SNP's (include the database reference number and web link) ---> | <!--- A description of the diseases and their associated SNP's (include the database reference number and web link) ---> | ||
The single nucleotide polymorphism (SNP), 137852571, that is being examined in this experiment is linked with | The single nucleotide polymorphism (SNP), 137852571, that is being examined in this experiment is linked with Androgen Insensitivity Syndrome and Kennedy Spinal and Bulbar Muscular Atrophy. Androgen Insensitivity Syndrome occurs when a person who is genetically male (who has one X and one Y chromosome) is resistant to male hormones (called androgens). As a result, the person has some or all of the physical traits of a female, but the genetic makeup of a male. The mutation on the X chromosome makes the body unable to respond to the hormones that produce a male appearance. Kennedy Spinal and Bulbar Muscular Atrophy is a debilitating neurodegenerative disease resulting in muscle cramps and progressive weakness due to degeneration of motor neurons in the brain stem and spinal cord. The SNP is located on the X chromosome and affects the gene AR, the gene is inherited in an x-linked recessive manner therefore only males can be fully affected by the mutation and females are rarely affected. The sequence of this gene is:<br> | ||
CTTCTCCAGGCTTCCGCAACTTACAC[A/G]TGGACGACCAGATGGCTGTCATTCA<br> | CTTCTCCAGGCTTCCGCAACTTACAC[A/G]TGGACGACCAGATGGCTGTCATTCA<br> | ||
The error in this sequence is represented by [A/G] which means that the normal G base pair has been mutated into an A base pair resulting in an allele that expresses the linked diseases.<br><br> | The error in this sequence is represented by [A/G] which means that the normal G base pair has been mutated into an A base pair resulting in an allele that expresses the linked diseases.<br><br> |
Revision as of 14:49, 27 November 2012
BME 103 Fall 2012 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | ||||||||||||||||
OUR TEAMLAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
Key Features
ProtocolsMaterials
PCR Protocol 1.) Pipet 0.1μL of template DNA, 0.5μL of 10μM forward primer, 0.5μL of 10μM reverse primer, 25.0μL of GoTaq Master Mix, and 23.9μL of dH20 in an Eppendorf tube. All of these items mixed together should create a total volume of 50.0μL. DNA Measurement Protocol Fluorimeter Setup Fluorimeter Measurements ImageJ Instructions Research and DevelopmentBackground on Disease Markers The single nucleotide polymorphism (SNP), 137852571, that is being examined in this experiment is linked with Androgen Insensitivity Syndrome and Kennedy Spinal and Bulbar Muscular Atrophy. Androgen Insensitivity Syndrome occurs when a person who is genetically male (who has one X and one Y chromosome) is resistant to male hormones (called androgens). As a result, the person has some or all of the physical traits of a female, but the genetic makeup of a male. The mutation on the X chromosome makes the body unable to respond to the hormones that produce a male appearance. Kennedy Spinal and Bulbar Muscular Atrophy is a debilitating neurodegenerative disease resulting in muscle cramps and progressive weakness due to degeneration of motor neurons in the brain stem and spinal cord. The SNP is located on the X chromosome and affects the gene AR, the gene is inherited in an x-linked recessive manner therefore only males can be fully affected by the mutation and females are rarely affected. The sequence of this gene is:
Breast Cancer
Normal: G mutates into cancer A Illustration
|