Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
System Design
Key Features
Instructions
Protocols
Materials
Supplied in the Kit
PCR Machine
10μM forward primer
10μM reverse primer
GoTaq master mix
Supplied by the User
Template DNA
Distilled Water
Pipets
Eppendorf Tubes
PCR Protocol
1.) Pipet 0.1μL of template DNA, 0.5μL of 10μM forward primer, 0.5μL of 10μM reverse primer, 25.0μL of GoTaq Master Mix, and 23.9μL of dH20 in an Eppendorf tube. All of these items mixed together should create a total volume of 50.0μL.
2.) Up to 16 of these samples are then loaded into the PCR machine
3.) The DNA samples are then heated to ninety-five degrees Celsius (95°C) for one (1) minute in order to unzip the two single strands.
4.) They are then cooled to fifty-seven degrees Celsius (57°C) for ten (10) seconds so that the primers can attach to their matching sequences.
5.) Finally they are heated back to seventy-two degrees Celsius (72°C) for ten (10) seconds and polymerase extends the DNA strands by attaching the correct free nucleotides in order on the single strands.
DNA Measurement Protocol
Fluorimeter Setup
1.) The lid was first taken off the the box and one of its sides was unbuttoned in order to create a flap.
2.) The box was the flipped upside down in order to create a dark environment for the camera.
3.) A hydrophobic slide was then inserted into the fluorimeter.
4.) Finally, the camera phone was placed in the stand.
Fluorimeter Measurements
1.) Label transfer pipettes and tubes
2.) Transfer each sample separately into tube containing 400μl of buffer
3.) Take the specifically labeled tube containing SYBR GREEN 1 and place 2 drops on the first 2 centered drops
4.) Place 2 drops of diluted sample on top of the SYBR GREEN 1 drop
5.) Align light through drop
6.) Take pictures using light box
7.) Repeat for each sample.
8.) Run water as BLANK using same procedure
ImageJ Instructions
1.) Open ImageJ
2.) Click ANALYZE tool bar and select SET MEASUREMENTS
3.) Select AREA, MEAN GREY VALUE, and INTEGRATED DENSITY
4.) Upload image to ImageJ
5.) Select IMAGE then COLOR and then SPLIT CHANNELS
6.) Only use green channel
7.) Use OVAL tool and select the entire drop of liquid
8.) Go to ANALYZE and then MEASURE
9.) Drag circle to the background of the image
10.) Record results
11.) Repeat if necessary
Research and Development
Background on Disease Markers
Breast Cancer
rs137852571
AR –
Reverse Primer:
SNP:5,255,325
Missense GTG→ATG
V[Val]→M[Met]
Chromosome X
Primer Design
Normal: G mutates into cancer A
CAACTTACACATGGACGACC
reverse primer:
GTTGAATGTGTACCTGCAGG
Forward primer starts at 5,255,175:
AGGGGTGGTGGGGAATTACC