BME103:T130 Group 4: Difference between revisions
Candice Chen (talk | contribs) |
Candice Chen (talk | contribs) |
||
(7 intermediate revisions by 3 users not shown) | |||
Line 96: | Line 96: | ||
<br> | <br> | ||
# Put the slide into the fluorimeter with the glass side facing down. | # Put the slide into the fluorimeter with the glass side facing down. | ||
# Using the pipette marked with the blue stripe, place one droplet of SYBR | # Using the pipette marked with the blue stripe, place one droplet of SYBR Green I in the middle well of the first row and one droplet of SYBR Green I in the middle well of the second row. The two droplets should combine into one big drop. | ||
# Using a separate clean pipette, add two droplets of the sample being tested to the SYBR | # Using a separate clean pipette, add two droplets of the sample being tested to the SYBR Green I drop. | ||
# Adjust the slide as needed so the drop is aligned with the fluorimeter's light. The light should shine through the middle of the drop when you turn it on. | # Adjust the slide as needed so the drop is aligned with the fluorimeter's light. The light should shine through the middle of the drop when you turn it on. | ||
# Adjust your smartphone camera's settings as follows: turn off the flash, set the ISO to ≥800, set the white balance to auto, set exposure and saturation to their highest settings, and set contrast to the lowest setting. | # Adjust your smartphone camera's settings as follows: turn off the flash, set the ISO to ≥800, set the white balance to auto, set exposure and saturation to their highest settings, and set contrast to the lowest setting. | ||
Line 118: | Line 118: | ||
'''Specific Cancer Marker Detection - The Underlying Technology'''<br> | '''Specific Cancer Marker Detection - The Underlying Technology'''<br> | ||
The r17879961 sequence has a possible nucleotide alteration associated with cancer. When there is a replacement of a T nucleotide with a C nucleotide, a higher risk of cancer is known to occur. This variance is found in the bottom strand of DNA, so the bottom strand is considered the template DNA. (Note that this is the bottom strand that does have the cancer-associated C nucleotide). A DNA primer is developed that is 20 letters long. A DNA primer is essentially a synthetic copy of the DNA sequence. Another primer is made for the corresponding top strand 200 letters down the DNA sequence. For this specific cancer-associated sequence, the bottom primer is [AACTCTTACA'''C'''TGCATACAT] (the genetic variant "C" is bolded) and the top primer is [TAGTGACAGTGCAATTTCAG]. These primers will attach to the other half of the DNA, but only if there is a matching genetic code for them to attach to. The top primer should always have a matching pair to attach to because there should be no genetic variance in its counterpart while the bottom primer will only match up with its corresponding strand of DNA if the genetic variance is present. A Taq DNA polymerase then connects to any attached primers, which along with MgCl<sub>2</sub>, makes it possible for free-floating nucleotides to fill in the rest of the letters missing from the DNA strand. This process is then repeated numerous times. If the mutation is not present then only the top primer will find a match and the reproduction of DNA will not show a noticeable increase. If the mutation is present in the subject's DNA then both primers will find matching pairs and create two full new sets of this sequence. As the process is repeated the amount of the sequences present will increase exponentially. <br> | The r17879961 sequence has a possible nucleotide alteration associated with cancer. When there is a replacement of a T nucleotide with a C nucleotide, a higher risk of cancer is known to occur. This variance is found in the bottom strand of DNA, so the bottom strand is considered the template DNA. (Note that this is the bottom strand that does have the cancer-associated C nucleotide). A DNA primer is developed that is 20 letters long. A DNA primer is essentially a synthetic copy of the DNA sequence. Another primer is made for the corresponding top strand 200 letters down the DNA sequence. For this specific cancer-associated sequence, the bottom primer is [AACTCTTACA'''C'''TGCATACAT] (the genetic variant "C" is bolded) and the top primer is [TAGTGACAGTGCAATTTCAG]. These primers will attach to the other half of the DNA, but only if there is a matching genetic code for them to attach to. The top primer should always have a matching pair to attach to because there should be no genetic variance in its counterpart while the bottom primer will only match up with its corresponding strand of DNA if the genetic variance is present. A Taq DNA polymerase then connects to any attached primers, which along with MgCl<sub>2</sub>, makes it possible for free-floating nucleotides to fill in the rest of the letters missing from the DNA strand. This process is then repeated numerous times. If the mutation is not present then only the top primer will find a match and the reproduction of DNA will not show a noticeable increase. If the mutation is present in the subject's DNA then both primers will find matching pairs and create two full new sets of this sequence. As the process is repeated the amount of the sequences present will increase exponentially. <br> | ||
<br> | |||
'''Baye's Rule''' | |||
<br> | <br> | ||
The data can be further understood by applying Baye's Rule. Utilizing Baye's Rule lets you understand many different statistics about the data. <br> | The data can be further understood by applying Baye's Rule. Utilizing Baye's Rule lets you understand many different statistics about the data. <br> | ||
<br> | |||
Let:<br> | Let:<br> | ||
P(C)= Probability of having the C genetic variance in the r17879961 sequence<br> | P(C)= Probability of having the C genetic variance in the r17879961 sequence<br> | ||
Line 134: | Line 137: | ||
P(nc|nC)= Probability of not having cancer if you don't have the C genetic variance<br> | P(nc|nC)= Probability of not having cancer if you don't have the C genetic variance<br> | ||
<br> | <br> | ||
Obviously some of these stats are more useful than others. | Obviously some of these stats are more useful than others. Unfortunately not enough variables are known to solve for all of the probabilities.<br> | ||
<br> | <br> | ||
P(C)= 5.3%<br> | P(C)= 5.3%<br> | ||
P(nC)= 100% - P(C)= 94.7% | P(nC)= 100% - P(C)= 94.7% | ||
<br>P(C|hc)= 7.8% | <br>P(C|hc)= 7.8% | ||
<br>P(nC|hc)= 100% - P(C|hc) = 92.2% | <br>P(nC|hc)= 100% - P(C|hc) = 92.2%<br> | ||
<br> | <br> | ||
It is clear that all the values are related to each other in some way or another. | It is clear that all the values are related to each other in some way or another. If one other value was known then the entire set of probabilities could be solved for. Some equations that would be used are: | ||
If one other value was known then the entire set of probabilities could be solved for. Some equations that would be used are: | |||
<br> | <br> | ||
(((100%-P(hc))x P(C|nc)) + ((P(hc) x P(C|hc)) = P(C) | (((100%-P(hc))x P(C|nc)) + ((P(hc) x P(C|hc)) = P(C) | ||
Line 149: | Line 150: | ||
P(hc) x P(C|hc) x 1/P(C) = P(hc|C) | P(hc) x P(C|hc) x 1/P(C) = P(hc|C) | ||
<br> | <br> | ||
These values are important because they can show | These values are important because they can show sensitivity, specificity, positive predictive value (PPV), and negative predictive value (NPV). Sensitivity is P(C|hc). Specificity is P(nc|nC). PPV is P(hc|C). NPV is P(C|nc). Even though there are many values that we don't have, the data available still says a lot.<br> | ||
<br> | <br> | ||
[[Image:PCR_1.png]]<br> | [[Image:PCR_1.png]]<br> | ||
Line 201: | Line 202: | ||
| PCR: Patient 2 ID 81857, rep 3 || 2238068 || 1.38464 || Negative | | PCR: Patient 2 ID 81857, rep 3 || 2238068 || 1.38464 || Negative | ||
|} | |} | ||
Latest revision as of 21:40, 23 November 2012
BME 103 Fall 2012 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 1 WRITE-UPInitial Machine TestingThe Original Design The device above is a machine used for performing polymerase chain reactions (PCR). PCR is a process used to make copies of a particular DNA sequence in large enough quantities to be studied or analyzed. The machine has an internal oven for heating and cooling DNA samples and connects to your computer through a USB cable so you can program it. Part 2 is the temperature sensor, so when you unplug it from the brain board, the machine can no longer read any temperatures. ProtocolsPolymerase Chain Reaction
Research and DevelopmentSpecific Cancer Marker Detection - The Underlying Technology Results
KEY
|