BME103:T130 Group 6 l2: Difference between revisions
Line 151: | Line 151: | ||
<ul>Here are two examples:<br> | <ul>Here are two examples:<br> | ||
<li> <b>Single Nucleotide Polymorphism (SNP) - <font color="red">rs799917</font color></b><br> | <li> <b>Single Nucleotide Polymorphism (SNP) - <font color="red">rs799917</font color></b><br> | ||
[http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=799917 NCBI database] <br> | [http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=799917 NCBI database rs799917] <br> | ||
<u>Location:</u> <i>Chromosome 17 at position 41,244,936bp. </i><br> | <u>Location:</u> <i>Chromosome 17 at position 41,244,936bp. </i><br> | ||
<u>Variation Type:</u> <i>Single Nucleotide Variation</i>; Missense Mutation<br> | <u>Variation Type:</u> <i>Single Nucleotide Variation</i>; Missense Mutation<br> | ||
Line 158: | Line 158: | ||
<i>If Cytosine is replaced by Adenine or Thymine in this sequence the resulting amino acid would either be glutamine or leucine respectively instead of proline. This change in amino acids will result in an alteration to the overall protein. Something this small is what could cause a cancerous gene.</i> | <i>If Cytosine is replaced by Adenine or Thymine in this sequence the resulting amino acid would either be glutamine or leucine respectively instead of proline. This change in amino acids will result in an alteration to the overall protein. Something this small is what could cause a cancerous gene.</i> | ||
<br><br> | <br><br> | ||
<li> <b>Single Nucleotide Polymorphism - <font color="red">rs4986852</font color></b><br> | <li> | ||
<b>Single Nucleotide Polymorphism - <font color="red">rs4986852</font color></b><br> | |||
[http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=4986852 NCBI database rs4986852] <br> | |||
<u>Location:</u> <i>Chromosome 17 at position 41,244,429bp. </i><br> | <u>Location:</u> <i>Chromosome 17 at position 41,244,429bp. </i><br> | ||
<u>Variation Type:</u> <i>Single Nucleotide Variation</i>; Missense Mutation<br> | <u>Variation Type:</u> <i>Single Nucleotide Variation</i>; Missense Mutation<br> | ||
<u>Reference strand (<i>41,244,455 bp-41,244,404 bp</i>):</u> | <u>Reference strand (<i>41,244,455 bp-41,244,404 bp</i>): </u> | ||
<br><b>3'</b> TAGAGAAAATGTTTTTAAAGAAGCCA[<font color="red">A</font color>/G*]CTCAAGCAATATTAATGAAGTAGGT<b> 5'</b> <br> | <br><b>3'</b> TAGAGAAAATGTTTTTAAAGAAGCCA[<font color="red">A</font color>/G*]CTCAAGCAATATTAATGAAGTAGGT<b> 5'</b> <br> | ||
* This represents G as the normal base and C as the possible mutation for this SNP.<br> | * This represents G as the normal base and C as the possible mutation for this SNP.<br> | ||
<i>If Guanine is replaced with Cytosine then Asparagine will be produced instead of Serine which will also cause a change in the protein that has been connected to BRCA1.</i> | <i>If Guanine is replaced with Cytosine then Asparagine will be produced instead of Serine which will also cause a change in the protein that has been connected to BRCA1.</i> | ||
<br> | <br></li> | ||
</ul> | </ul> | ||
Line 171: | Line 173: | ||
<br><br> | <br><br> | ||
'''Primer Design''' | '''Primer Design''' | ||
In order for the PCR to replicate only the DNA which contains the viral mutation we had to design specific primers for each SNP.<br> | |||
<br><ul><li><b>SNP - rs799917</b><br> | |||
<b><u>Forward Primer:</u>5'</b>GCTTATCTTTCTGACCAACC<b>3'</b><br> | <b><u>Forward Primer:</u>5'</b>GCTTATCTTTCTGACCAACC<b>3'</b><br> | ||
<i>located at approximately 41,244,736 - 41,244,756; 200bp to the left of the mutation</i><br> | <i>located at approximately 41,244,736 - 41,244,756; 200bp to the left of the mutation</i><br> | ||
<b><u>Reverse Primer:</u>3'</b>TCATTGCTC<font color="red">A/T</font color>GTTTTCAAA<b>5'</b><br> | <b><u>Reverse Primer:</u>3'</b>TCATTGCTC<font color="red">A/T</font color>GTTTTCAAA<b>5'</b><br><br></li> | ||
<li><b>SNP - rs4986852</b><br> | |||
<!--- Include the sequences of your forward and reverse primers. Explain why a disease allele will give a PCR product and the non-disease allele will not. ---> | <!--- Include the sequences of your forward and reverse primers. Explain why a disease allele will give a PCR product and the non-disease allele will not. ---> |
Revision as of 05:38, 29 November 2012
BME 103 Fall 2012 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||
OUR TEAMLAB 2 WRITE-UP
PCR Machine Improvements
Thermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
Key Features
Instructions
ProtocolsMaterials
Research and DevelopmentBreast Cancer Markers
Background on Disease Markers
|