BME103:T130 Group 9 l2: Difference between revisions
Bryce Munter (talk | contribs) |
Bryce Munter (talk | contribs) |
||
(5 intermediate revisions by 2 users not shown) | |||
Line 16: | Line 16: | ||
| [[Image:BME103student.jpg|100px|thumb|Name: Daniel Saman<br>Machine Engineer]] | | [[Image:BME103student.jpg|100px|thumb|Name: Daniel Saman<br>Machine Engineer]] | ||
| [[Image:181519_10150181265938916_659243915_8769541_1300171_n.jpg|100px|thumb|Name: Bryce Munter<br>R & D Scientist]] | | [[Image:181519_10150181265938916_659243915_8769541_1300171_n.jpg|100px|thumb|Name: Bryce Munter<br>R & D Scientist]] | ||
| [[Image: | | [[Image:DavidProbst.jpg|100px|thumb|Name: David Probst<br>R&D Scientist]] | ||
| [[Image:BME103student.jpg|100px|thumb|Name: Adrian Munoz<br>Machine Engineer]] | | [[Image:BME103student.jpg|100px|thumb|Name: Adrian Munoz<br>Machine Engineer]] | ||
|} | |} | ||
Line 162: | Line 162: | ||
We chose to make two different improvements to the PCR thermalcycler device, one that relates predominantly to the machine itself and one that relates predominantly to the research and development section of the group. The second improvement that we are planning is the ability to test for multiple strands of mutations via one PCR test. There are many different mutations cause one type of cancer (IE – there are 5 different mutations that cause pancreatic cancer) and therefore if we could include primers that detect for all these different mutations, we determine if the patient has Pancreatic Cancer with one test, not five different ones. | We chose to make two different improvements to the PCR thermalcycler device, one that relates predominantly to the machine itself and one that relates predominantly to the research and development section of the group. The second improvement that we are planning is the ability to test for multiple strands of mutations via one PCR test. There are many different mutations cause one type of cancer (IE – there are 5 different mutations that cause pancreatic cancer) and therefore if we could include primers that detect for all these different mutations, we determine if the patient has Pancreatic Cancer with one test, not five different ones. | ||
Pancreatic Carcinoma (most commonly referred to as pancreatic cancer) is a cancer of or tumor in the pancreas, a vital organ in both the digestive system and the endocrine system. | |||
'''Pancreatic Cancer''' | '''Pancreatic Cancer''' | ||
Line 189: | Line 183: | ||
Reverse Primer Tm: 61 °C | Reverse Primer Tm: 61 °C | ||
'''Bayes:''' | |||
(p(A→T×%positive of Pancreatic Cancer)×p(General populations probability of Cancer))÷(p(A→T×%positive of Pancreatic Cancer)+p(A→T×%negative of Pancreatic Cancer)×p(General populations probability of not having Cancer)) | |||
Line 209: | Line 206: | ||
Reverse Primer 2 Tm: 54 °C | Reverse Primer 2 Tm: 54 °C | ||
'''Bayes:''' | |||
(p(G→C×%positive of Pancreatic Cancer)×p(General populations probability of Cancer))÷(p(G→C×%positive of Pancreatic Cancer)+p(G→C×%negative of Pancreatic Cancer)×p(General populations probability of not having Cancer)) | |||
Line 229: | Line 229: | ||
Reverse Primer 2 Tm: 30 °C | Reverse Primer 2 Tm: 30 °C | ||
'''Bayes:''' | |||
(p(C→G×%positive of Pancreatic Cancer)×p(General populations probability of Cancer))÷(p(C→G×%positive of Pancreatic Cancer)+p(C→G×%negative of Pancreatic Cancer)×p(General populations probability of not having Cancer)) | |||
Mutation 4: rs121912662 | Mutation 4: rs121912662 | ||
On chromosome 17 | On chromosome 17 | ||
Mutation 5: rs121908291 | Mutation 5: rs121908291 | ||
On chromosome 4 | On chromosome 4 | ||
<br><br> | <br><br> | ||
'''Our improvement:''' | '''Our improvement:''' | ||
Line 247: | Line 251: | ||
'''Illustration''' | '''Illustration''' | ||
[[Image:Illustration for Lab 2.png]] | |||
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | <!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | ||
|} | |} |
Latest revision as of 15:31, 29 November 2012
BME 103 Fall 2012 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 2 WRITE-UPThermal Cycler EngineeringOne of our re-designs is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
Installing the new modifications is a simple task as not much has changed and only one thing has been added. 1. Attach keypad to the extended portion of the top cover with the included screws. 2. Feed the wire through the machine and attach it to the circuit board. 3. The micro processor is fitted on the circuit board and a small wire is connected to the base of the circuit board. 4. The LCD now fits inside the larger top cover in the same spot.
ProtocolsMaterials
The following materials will need to be supplied by the user:
PCR Protocol In order to perform PCR, the samples must first be prepared. This is done by adhering to the following steps: Now that the samples have been prepared, the PCR machine must then be configured to the specific cycling and temperature needs of your experiment. In this case, the instructions for carrying out PCR in one manner are as follows:
Now collection of the data may begin. This is done first by making sure that the experiment worked using the calf thymus DNA as a standard and then measuring the amount of green light from the added dye there is in order to determine the concentration of DNA: Research and DevelopmentBackground on Disease Markers We chose to make two different improvements to the PCR thermalcycler device, one that relates predominantly to the machine itself and one that relates predominantly to the research and development section of the group. The second improvement that we are planning is the ability to test for multiple strands of mutations via one PCR test. There are many different mutations cause one type of cancer (IE – there are 5 different mutations that cause pancreatic cancer) and therefore if we could include primers that detect for all these different mutations, we determine if the patient has Pancreatic Cancer with one test, not five different ones. Pancreatic Carcinoma (most commonly referred to as pancreatic cancer) is a cancer of or tumor in the pancreas, a vital organ in both the digestive system and the endocrine system. Pancreatic Cancer Mutation 1: rs121912579 On chromosome 18 AGA>TGA: Arginine>Isoleucine Occurs @ 48,604,721, changes SMAD4 Gene (nonsense) Primer: TGACAGAGCATCAAAGAAAC Reverse Primer: GGGTCTGCAATCGGCATGGT Temperature Cycle: Anneal Temp: 44 °C Primer 1 Tm: 49 °C Reverse Primer Tm: 61 °C Bayes: (p(A→T×%positive of Pancreatic Cancer)×p(General populations probability of Cancer))÷(p(A→T×%positive of Pancreatic Cancer)+p(A→T×%negative of Pancreatic Cancer)×p(General populations probability of not having Cancer))
On chromosome 18 GAT>CAT: Aspartic Acid>Histidine Occurs @ 48,604,655, changed SMAD4 Gene – signal transduction protein (Missense) Primer: CATGACCTTCGTCGCTTATG Reverse Primer: CCCCAACGGTAAAAGACCTC Temperature Cycle: Anneal Temp: 49 °C Primer 1 Tm: 54 °C Reverse Primer 2 Tm: 54 °C Bayes: (p(G→C×%positive of Pancreatic Cancer)×p(General populations probability of Cancer))÷(p(G→C×%positive of Pancreatic Cancer)+p(G→C×%negative of Pancreatic Cancer)×p(General populations probability of not having Cancer))
On chromosome 18 TAC >TAG: Tyrosine > Stop(Amber) Occurs @ 48,593,485, changes SMAD4 Gene (Nonsense) Primer: TAGTACTTAGACAGAGAGAA Reverse Primer: TAAATAAATAAAATTAAAAA Temperature Cycle Anneal Temp: 25 °C Primer 1 Tm: 46 °C Reverse Primer 2 Tm: 30 °C Bayes: (p(C→G×%positive of Pancreatic Cancer)×p(General populations probability of Cancer))÷(p(C→G×%positive of Pancreatic Cancer)+p(C→G×%negative of Pancreatic Cancer)×p(General populations probability of not having Cancer))
On chromosome 17 Mutation 5: rs121908291 On chromosome 4
|