BME103:T930 Group 1: Difference between revisions
Joseph Heath (talk | contribs) |
Joseph Heath (talk | contribs) |
||
Line 100: | Line 100: | ||
[[Image:BME103_Group1_Flourimeter.jpg|250px|Patients and Samples]]<br> | [[Image:BME103_Group1_Flourimeter.jpg|250px|Patients and Samples]]<br> | ||
'''Samples''' <br> | '''Samples''' <br> | ||
[[Image:BME103_Group1_Samples.jpg|250px|Patients and Samples]]<br>Sample Labels and Patient Numbers | [[Image:BME103_Group1_Samples.jpg|250px|Patients and Samples]]<br>Sample Labels and Patient Numbers <br> | ||
'''Image J Procedure'''<br> | |||
1. Search Image J in Google and then download Image J <br> | |||
2. Open Image J then click "file" and click "open" and open the image you want to analyze <br> | |||
3. Once your image is open click "analyze" and then click "set measurements" and check the boxes "area" "integrated density" and "mean gray value" leave the rest of the boxes empty <br> | |||
4. now click "image" then click "color" and then click "split channels" <br> | |||
5. This will split your image into three, you will use the one that is marked as the "green" picture, cancel the others <br> | |||
6. Activate the oval tool <br> | |||
7. draw the best oval you can around the drop and then press the control button+ the "m" key <br> | |||
8. Move the oval over to the background (the black around the picture) and press the control button and the m key again <br> | |||
9. repeat steps for all pictures <br> | |||
10. Save your data in an excel format by clicking "file" and then clicking "save as" then save the file with the name you want <br> | |||
<br><br> | <br><br> | ||
Revision as of 23:15, 14 November 2012
BME 103 Fall 2012 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 1 WRITE-UPInitial Machine Testing
This machine is called an Open PCR machine. PCR stands for polymerase chain reaction, and this machine helps us create specific strands of DNA. It can hold 16 tubes of DNA and is compatible with any computer that has the appropriate downloaded software. The machine goes through a series of steps to recreate the DNA. First, it heats up to break apart the DNA strands. Then, it cools down to allow polymer chains to attach to the target DNA sequence. Once the primers are attached, the machine will heat up again so that the protein in charge of DNA construction will activate and bind to the polymers and then start to build the DNA sequences that are targeted. This machine is capable of replicating millions of segments of a specific DNA sequence in just an hour or two. This machine, like many others, can be improved but for standard use, this machine works fine as is. If we improve this machine, the process that the machine goes through will most likely be the same but the hardware of the Open PCR machine may be changed. For example, if we wanted to make the amount of time for each cycle shorter, we could improve the heating elements of the machine so that the heating and cooling will be faster and more effective.
When we unplugged the mounting plate from the open PCR circuit board, the display screen on the PCR box did not work. When we unplugged the white wire that connects the open PCR circuit board to the heating block, there was no temperature reading on the display screen.
(First Open PCR test: 10/25/12. We had a successful and simple run of PCR)
ProtocolsPolymerase Chain Reaction Components of the PCR Master Mix 1. Modified Taq DNA polymerase 1. Thaw the GoTaq Colorless Master Mix at room temperature. Vortex the Master Mix, then spin it briefly in a microcentrifuge to collect the material at the bottom of the tube. 2. Prepare the following reaction mix on ice:
3. If using a cycler without a heated lid, overlay the reaction mix with 1-2 drops of mineral oil to prevent evaporation during thermal cycling. Centrifuge the reaction mix in a microcentrifuge for 5 seconds. 4. Place the reactions in a thermal cycler that has been preheated to 95 degrees Celsius. Perform PCR. How To Amplify A Patient's DNA Sample 2. Annealing: perform the reaction about 5 degrees Celsius below the calculated melting temperature of the primers and
increasing the temperature in increments of 1°C to the annealing temperature; this should occur anywhere between 30 seconds and 1 minute. 3. Extension: performed between 72-74 degrees Celsius, extension allows 1 minute for every 1 kb of DNA to be amplified; the suggested time for extension is 5 minutes. 4. Refrigeration: refrigerate the tubes at 4 degrees Celsius for several hours; this will minimize the opportunity for DNA polymerase to continue to be active at higher temperatures. 5. Cycle Number: the optimal amplification is 25-30 cycles, but up to 40 may be performed. Flourimeter Measurements Flourimeter Procedure 1. turn on the excitation light using the switch for the Blue LED. Research and DevelopmentSpecific Cancer Marker Detection - The Underlying Technology The r17879961 cancer-associated sequence (AAACTCTTACACTGCATACA) will produce a DNA signal because of its nucleotide variation (ACATTGC to ACACTGC). This T-C change results in an isoleucene to threonine substitution. In a study in Finland, patients with colorectal cancer (CRC), the most common cancer associated with the DNA sequence change, had the allele 7.8% of the time while patients without CRC had the allele in 5.3% of patients, showing a significantly higher association in CRC patients.[1] PCR detection will only give a signal if this allele is present.
Results
References |