BME103:T930 Group 1: Difference between revisions
No edit summary |
|||
(One intermediate revision by one other user not shown) | |||
Line 12: | Line 12: | ||
|- valign="top" | |- valign="top" | ||
| [[Image:Joseph Heath.jpg|100px|thumb|Joseph Heath:<br>Research & Development Scientist & PCR Machine Engineer]] | | [[Image:Joseph Heath.jpg|100px|thumb|Joseph Heath:<br>Research & Development Scientist & PCR Machine Engineer]] | ||
| [[Image: | | [[Image:Jessica Kemper.jpg|100px|thumb|Jessica Kemper:<br>Experimental Protocol Planner]] | ||
| [[Image:BME103_Group1_Maile.jpg|100px|thumb|Maile Ravenkamp:<br>Experimental Protocol Planner]] | | [[Image:BME103_Group1_Maile.jpg|100px|thumb|Maile Ravenkamp:<br>Experimental Protocol Planner]] | ||
| [[Image:Sexy crew.jpg|100px|thumb|Nick Hool:<br>PCR Machine Engineer]] | | [[Image:Sexy crew.jpg|100px|thumb|Nick Hool:<br>PCR Machine Engineer]] | ||
Line 101: | Line 101: | ||
'''Flourimeter Procedure'''<br> | '''Flourimeter Procedure'''<br> | ||
1. | 1. Turn on the excitation light using the switch for the Blue LED. <br> | ||
2. Place your smart phone on the cradle at a right angle from the slide. <br> | 2. Place your smart phone on the cradle at a right angle from the slide. <br> | ||
3. Turn on the camera setting on the smartphone. Turn off the flash and set the ISO to 800 or higher and increase the exposure to maximum. You should also turn off the autofocus, if possible, and make sure that you can take an image where the drop on the slide will be in focus. <br> | 3. Turn on the camera setting on the smartphone. Turn off the flash and set the ISO to 800 or higher and increase the exposure to maximum. You should also turn off the autofocus, if possible, and make sure that you can take an image where the drop on the slide will be in focus. <br> |
Latest revision as of 10:44, 15 November 2012
BME 103 Fall 2012 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
LAB 1 WRITE-UPInitial Machine Testing
This machine is called an Open PCR machine. PCR stands for polymerase chain reaction, and this machine helps us create specific strands of DNA. It can hold 16 tubes of DNA and is compatible with any computer that has the appropriate downloaded software. The machine goes through a series of steps to recreate the DNA. First, it heats up to break apart the DNA strands. Then, it cools down to allow polymer chains to attach to the target DNA sequence. Once the primers are attached, the machine will heat up again so that the protein in charge of DNA construction will activate and bind to the polymers and then start to build the DNA sequences that are targeted. This machine is capable of replicating millions of segments of a specific DNA sequences in just an hour or two. This machine, like many others, can be improved but for standard use, this machine works fine as is. If we improve this machine, the process that the machine goes through will most likely be the same but the hardware of the Open PCR machine may be changed. For example, if we wanted to make the amount of time for each cycle shorter, we could improve the heating elements of the machine so that the heating and cooling will be faster and more effective.
When we unplugged the mounting plate from the open PCR circuit board, the display screen on the PCR box did not work. When we unplugged the white wire that connects the open PCR circuit board to the heating block, there was no temperature reading on the display screen.
(First Open PCR test: 10/25/12. We had a successful and simple run of PCR)
ProtocolsPolymerase Chain Reaction The open PCR machine works by first denaturing the DNA, causing it to separate. Once that occurs, the sample is cooled at 50 to 60 degrees Celsius. Then, the samples are raised to 72°C to allow Taq DNA to extend the DNA sequences, which then creates 4 DNA strands. This occurs four more times, resulting in 32 strands of DNA. The suggested amount of cycles is 25 to 30. After the amount of cycles, the strands are separated usually during gel electrophoresis. Components of the PCR Master Mix 1. Modified Taq DNA polymerase 1. Thaw the GoTaq Colorless Master Mix at room temperature. Vortex the Master Mix, then spin it briefly in a microcentrifuge to collect the material at the bottom of the tube. 2. Prepare the following reaction mix on ice:
4. Place the reactions in a thermal cycler that has been preheated to 95 degrees Celsius. Perform PCR. How To Amplify A Patient's DNA Sample 2. Annealing: perform the reaction about 5 degrees Celsius below the calculated melting temperature of the primers and
increasing the temperature in increments of 1°C to the annealing temperature; this should occur anywhere between 30 seconds and 1 minute. 3. Extension: performed between 72-74 degrees Celsius, extension allows 1 minute for every 1 kb of DNA to be amplified; the suggested time for extension is 5 minutes. 4. Refrigeration: refrigerate the tubes at 4 degrees Celsius for several hours; this will minimize the opportunity for DNA polymerase to continue to be active at higher temperatures. 5. Cycle Number: the optimal amplification is 25-30 cycles, but up to 40 may be performed. Flourimeter Measurements Flourimeter Procedure 1. Turn on the excitation light using the switch for the Blue LED.
Image J Procedure Research and DevelopmentBaye's Rule Baye's Rule equation: p(A/B)= (p(B/A)p(A))/p(B)
The r17879961 cancer-associated sequence (AAACTCTTACACTGCATACA) will produce a DNA signal because of its nucleotide variation (ACATTGC to ACACTGC). This T-C change results in an isoleucene to threonine substitution. In a study in Finland, patients with colorectal cancer (CRC), the most common cancer associated with the DNA sequence change, had the allele 7.8% of the time while patients without CRC had the allele in 5.3% of patients, showing a significantly higher association in CRC patients.[1] PCR detection will only give a signal if this allele is present.
Results
References"GoTaq® Colorless Master Mix (M714) Product Information." GoTaq® Colorless Master Mix Protocol. Promega, 2012. Web. 15 Nov. 2012. <http://www.promega.com/resources/protocols/product-information-sheets/g/gotaq-colorless-master-mix-m714-protocol/>. Hunt, Margaret. "Real Time PCR Tutorial." Real Time PCR Tutorial. University of South Carolina, 10 July 2010. Web. 15 Nov. 2012. <http://pathmicro.med.sc.edu/pcr/realtime-home.htm>. |