BME103:T930 Group 1

BME 103 Fall 2012	Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help
OUR TEAM Joseph Heath: Research & Development Scientist Jessica Kemper: Experimental Protocol Planner Maile Ravenkamp: Experimental Protocol Planner Nick Hool: PCR Machine Engineer Christian Boden: PCR Machine Engineer LAB 1 WRITE-UP (Please finish by 11/7/2012) Initial Machine Testing The Original Design Write a paragraph description for visitors who have no idea what this is) Experimenting With the Connections When we unplugged the mounting plate from the open PCR circuit board, the display screen on the PCR box did not work. When we unplugged the white wire that connects the open PCR circuit board to the heating block, there was no temperature reading on the display screen. Test Run (First Open PCR test: 10/25/12. We had a successful and simple run of PCR) Protocols Polymerase Chain Reaction Reagents and volumes used in PCR replication Flourimeter Measurements (Add your work from Week 3, Part 2 here) Research and Development Specific Cancer Marker Detection - The Underlying Technology The r17879961 cancer-associated sequence (AAACTCTTACACTGCATACA) will produce a DNA signal because of its nucleotide variation (ACATTGC to ACACTGC). This T-C change results in an isoleucene to threonine substitution. In a study in Finland, patients with colorectal cancer (CRC), the most common cancer associated with the DNA sequence change, had the allele 7.8% of the time while patients without CRC had the allele in 5.3% of patients, showing a significantly higher association in CRC patients.[1] PCR detection will only give a signal if this allele is present. Results (Your group will add the results of your Fluorimeter measurements from Week 4 here)