BME103:T930 Group 1

From OpenWetWare

Revision as of 17:12, 9 November 2012 by Maile Ravenkamp (Talk | contribs)
Jump to: navigation, search
BME 103 Fall 2012 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help
Image:BME494_Asu_logo.png

Contents

OUR TEAM

Joseph Heath:Research & Development Scientist & PCR Machine Engineer
Joseph Heath:
Research & Development Scientist & PCR Machine Engineer
Jessica Kemper:Experimental Protocol Planner
Jessica Kemper:
Experimental Protocol Planner
Maile Ravenkamp:Experimental Protocol Planner
Maile Ravenkamp:
Experimental Protocol Planner
Nick Hool:PCR Machine Engineer
Nick Hool:
PCR Machine Engineer
Christian Boden:PCR Machine Engineer & Research & Development Scientist
Christian Boden:
PCR Machine Engineer & Research & Development Scientist

LAB 1 WRITE-UP

(Please finish by 11/7/2012)

Initial Machine Testing

The Original Design
Image:Something that makes sense.png


For Those who don't know that this machine is or what it does, this is called an Open PCR machine. PCR stands for Polymerase Chain Reaction, So this machine helps us create specific strands of DNA. The machine goes through steps to recreate the DNA, it will heat up to break apart the DNA strands and then it cools down to allow polymer chains to attach to the target DNA sequence. Once the primers are attached the machine will heat up again so that the protein in charge of DNA construction will activate and bind to the polymers and then start to build the DNA sequences that are targeted. This machine is capable of creating millions of segments of this specific DNA sequence in just a hour or two. This machine can of course be improved but for many uses this machine is fine the way it is. If we improve this machine the process that the machine goes through will most likely be the same but the hardware of the Open PCR machine can be changed. Say we wanted to make the cycle times quicker we could improve the heating elements of the machine so that the heating and cooling will be faster and more effective.


Experimenting With the Connections

When we unplugged the mounting plate from the open PCR circuit board, the display screen on the PCR box did not work.

When we unplugged the white wire that connects the open PCR circuit board to the heating block, there was no temperature reading on the display screen.


Test Run

(First Open PCR test: 10/25/12. We had a successful and simple run of PCR)




Protocols

Polymerase Chain Reaction

Reagents and Volumes used in PCR replication
Reagents and volumes used in PCR replication

Flourimeter Measurements

(Add your work from Week 3, Part 2 here)

Samples
Patient Number:

43417 Male Age 62

11260 Female Age 47




Research and Development

Specific Cancer Marker Detection - The Underlying Technology

The r17879961 cancer-associated sequence (AAACTCTTACACTGCATACA) will produce a DNA signal because of its nucleotide variation (ACATTGC to ACACTGC). This T-C change results in an isoleucene to threonine substitution. In a study in Finland, patients with colorectal cancer (CRC), the most common cancer associated with the DNA sequence change, had the allele 7.8% of the time while patients without CRC had the allele in 5.3% of patients, showing a significantly higher association in CRC patients.[1] PCR detection will only give a signal if this allele is present.



Results

Sample Integrated Density DNA μg/mL Conclusion
PCR: Negative Control E6 F6 G6
PCR: Positive Control E7 F7 G7
PCR: Patient 1 ID #####, rep 1 E8 F8 G8
PCR: Patient 1 ID #####, rep 2 E9 F9 G9
PCR: Patient 1 ID #####, rep 3 E10 F10 G10
PCR: Patient 2 ID #####, rep 1 E11 F11 G11
PCR: Patient 2 ID #####, rep 2 E12 F12 G12
PCR: Patient 2 ID #####, rep 3 E13 F13 G13


KEY

  • Sample =
  • Integrated Density =
  • DNA μg/mL =
  • Conclusion =
Personal tools