BME103:T930 Group 1

From OpenWetWare

Revision as of 15:14, 14 November 2012 by Joseph Heath (Talk | contribs)
Jump to: navigation, search
BME 103 Fall 2012 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help
Image:BME494_Asu_logo.png

Contents

OUR TEAM

Joseph Heath:Research & Development Scientist & PCR Machine Engineer
Joseph Heath:
Research & Development Scientist & PCR Machine Engineer
Jessica Kemper:Experimental Protocol Planner
Jessica Kemper:
Experimental Protocol Planner
Maile Ravenkamp:Experimental Protocol Planner
Maile Ravenkamp:
Experimental Protocol Planner
Nick Hool:PCR Machine Engineer
Nick Hool:
PCR Machine Engineer
Christian Boden:PCR Machine Engineer & Research & Development Scientist
Christian Boden:
PCR Machine Engineer & Research & Development Scientist

LAB 1 WRITE-UP

Initial Machine Testing

The Original Design
Image:Something that makes sense.png


This machine is called an Open PCR machine. PCR stands for polymerase chain reaction, and this machine helps us create specific strands of DNA. It can hold 16 tubes of DNA and is compatible with any computer that has the appropriate downloaded software. The machine goes through a series of steps to recreate the DNA. First, it heats up to break apart the DNA strands. Then, it cools down to allow polymer chains to attach to the target DNA sequence. Once the primers are attached, the machine will heat up again so that the protein in charge of DNA construction will activate and bind to the polymers and then start to build the DNA sequences that are targeted. This machine is capable of replicating millions of segments of a specific DNA sequence in just an hour or two. This machine, like many others, can be improved but for standard use, this machine works fine as is. If we improve this machine, the process that the machine goes through will most likely be the same but the hardware of the Open PCR machine may be changed. For example, if we wanted to make the amount of time for each cycle shorter, we could improve the heating elements of the machine so that the heating and cooling will be faster and more effective.


Experimenting With the Connections

When we unplugged the mounting plate from the open PCR circuit board, the display screen on the PCR box did not work.

When we unplugged the white wire that connects the open PCR circuit board to the heating block, there was no temperature reading on the display screen.


Test Run

(First Open PCR test: 10/25/12. We had a successful and simple run of PCR)




Protocols

Polymerase Chain Reaction

Components of the PCR Master Mix

1. Modified Taq DNA polymerase
2. dNTP's
3. MgCl2
4. reaction buffers

1. Thaw the GoTaq Colorless Master Mix at room temperature. Vortex the Master Mix, then spin it briefly in a microcentrifuge to collect the material at the bottom of the tube.

2. Prepare the following reaction mix on ice:

Reagents and Volumes used in PCR replication
Reagents and volumes used in PCR replication

3. If using a cycler without a heated lid, overlay the reaction mix with 1-2 drops of mineral oil to prevent evaporation during thermal cycling. Centrifuge the reaction mix in a microcentrifuge for 5 seconds.

4. Place the reactions in a thermal cycler that has been preheated to 95 degrees Celsius. Perform PCR.

How To Amplify A Patient's DNA Sample
1. Denaturation: a 2-minute denaturation at 95 degrees celsius.

2. Annealing: perform the reaction about 5 degrees Celsius below the calculated melting temperature of the primers and increasing the temperature in increments of 1°C to the annealing temperature; this should occur anywhere between 30 seconds and 1 minute.

3. Extension: performed between 72-74 degrees Celsius, extension allows 1 minute for every 1 kb of DNA to be amplified; the suggested time for extension is 5 minutes.

4. Refrigeration: refrigerate the tubes at 4 degrees Celsius for several hours; this will minimize the opportunity for DNA polymerase to continue to be active at higher temperatures.

5. Cycle Number: the optimal amplification is 25-30 cycles, but up to 40 may be performed.

Flourimeter Measurements

(Add your work from Week 3, Part 2 here)
Patients and Samples
Samples
Patients and Samples
Sample Labels and Patient Numbers



Research and Development

Specific Cancer Marker Detection - The Underlying Technology

The r17879961 cancer-associated sequence (AAACTCTTACACTGCATACA) will produce a DNA signal because of its nucleotide variation (ACATTGC to ACACTGC). This T-C change results in an isoleucene to threonine substitution. In a study in Finland, patients with colorectal cancer (CRC), the most common cancer associated with the DNA sequence change, had the allele 7.8% of the time while patients without CRC had the allele in 5.3% of patients, showing a significantly higher association in CRC patients.[1] PCR detection will only give a signal if this allele is present.



Results

Sample Integrated Density DNA μg/mL Conclusion
PCR: Negative Control 13908255 F6 clear
PCR: Positive Control 27282151 F7 green
PCR: Patient 1 ID 43417, rep 1 35526894 F8 green
PCR: Patient 1 ID 43417, rep 2 19073943 F9 green
PCR: Patient 1 ID 43417, rep 3 29391013 F10 green
PCR: Patient 2 ID 11260 , rep 1 1903450 F11 clear
PCR: Patient 2 ID 11260, rep 2 5214727 F12 slightly green
PCR: Patient 2 ID 11260, rep 3 5099077 F13 slightly green


KEY

  • Sample =
  • Integrated Density =
  • DNA μg/mL =
  • Conclusion =
Personal tools