BME103:T930 Group 10

BME 103 Fall 2012	Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help
OUR TEAM Name: Nolan Bidese Role: Research and Development Specialist Name: Evan Austin Role: Open PCR Machine Engineer Name: Aldin Malkoc Role: Open PCR Machine Engineer Name: Mikayle Holm Role: Experimental Protocol Planner Name: Coleen Fox Role: Experimental Protocol Planner LAB 1 WRITE-UP Initial Machine Testing The Original Design Experimenting With the Connections When we unplug the circuit board from the mounting plate, the LED display on the PCR machine stopped functioning. When we unplugged the white wire that connects the Open PCR circuit board to the heating plate, the temperature recordings that were displayed on the LED display stopped functioning. Test Run (Write the date you first tested Open PCR and your experience(s) with the machine) Protocols Polymerase Chain Reaction Polymerase Chain Reaction (PCR) is a technique used to amplify fragments of DNA. This allows researchers to see the base sequence of the DNA. It works by the DNA polymerase enzyme synthesizes a complementary strand of the fragmented DNA when mixed with primers that signal where the DNA sequencing should begin. When the DNA polymerase enzyme, MgCL2, dNTP’s, forward primer, and reverse primers are all added to the test tubes and placed in the PCR machine, the mixture is first heated to separate the double helix, then cooled to allow the primers to bind. After the primers bind, the polymerase completes the new complementary strands. The PCR machine then repeats heating and cooling cycles to multiply the fragmented DNA. After a couple hours, the now amplified segments of DNA can be analyzed to test for a cancer marker. Procedure: 1. Add a fragment of double stranded DNA, the pre-mixed Taq DNA polymerase, MgCl2, dNTPs, forward and reverse primers, and the DNA polymerase enzyme to test tube. 2. Place in PCR machine. 3. Set the following PCR cycle stages: Stage 1: 1 cycle, 95 degrees Celsius for 180 seconds (separate the DNA double helix) Stage 2: 30 cycles, 95 degrees Celsius for 30 seconds, 57 degrees Celsius for 30 seconds, 72 degrees Celsius for 30 seconds (separate the DNA double helix, primers bind to single strands of DNA at 57 degrees Celsius, DNA polymerase enzyme adds bases to singles strands of DNA segments at 72 degrees Celsius, cycle is repeated so the DNA is multiplied) Stage 3: 72 degrees for 180 seconds (final nucleotides are added) Final Hold: 4 degrees Celsius 4. Run the PCR machine. 5. After about 2 hours, the cycles should be completed. DNA can now be used for research and testing for a cancer marker. The PCR (GoTaq) Master Mix is advertised as a “ready-to-use solution” and it contains the Taq DNA polymerase, dNTPs, MgCl2 and reaction buffers. These substances are mixed at proper concentrations so the user can achieve a useable amplification of DNA segments by PCR. Reagent Volume Template DNA (20 ng) 0.1μL 10μM forward primer 0.5μL 10μM reverse primer 0.5μL GoTaq master mix 25.0μL dH2O 23.9μL Total Volume 50.0μL Samples Test tube 1- Positive Control Cancer DNA template Test tube 2- Patient 1 Replicate 1 Test tube 3- Patient 1 Replicate 2 Test tube 4- Patient 1 Replicate 3 Test tube 5- Negative Control DNA Template Test tube 6- Patient 2 Replicate 1 Test tube 7- Patient 2 Replicate 2 Test tube 8- Patient 2 Replicate 3 Patient Information Patient Number Patient Identification Number Gender Age 1 30576 Male 46 2 96210 Male 59 Fluorimeter Measurements Fluorimeter set up Procedure: 1. Number transfer pipettes to match Eppendorf tubes. 2. Transfer each separately into an Eppendorf tube containing 400ml of buffer. Label tube with matching sample number. 3. Take the specially labeled Eppendorf tube containing SYBR GREEN I and place two drops on the first two centered drops on slide, using the correct pipette. 4. Now take diluted sample and place two drops on top of the SYBR GREEN I drops. 5. Turn on fluorimeter. Align light to center of drops. Place smart phone next to slides on fluorimeter. 6. Let smartphone operator take pictures under light box. 7. Run this procedure for all 8 samples, including positive and negative controls. Also run with water from scintillation vial and the DNA from a calf thymus. 8. Record results with pictures. Image J Procedure: 1. Save the pictures to smart phone. 2. Download the pictures onto a computer that has Image J. 3. Open them with Image J by going to add image. Find image. Research and Development Specific Cancer Marker Detection - The Underlying Technology The DNA sequence r17879961 is the cancer-associated sequence for Colon Rectal Cancer. The goal of this experiment was to detect a cancer-associated sequence in a PCR machine and through the detection method. PCR stands for polymerase chain reaction, a method that uses DNA polymerase and primers, small sets of DNA, to amplify a sample of DNA to study and see specific sequences in it. Through thermal cycling, DNA sequences are melted apart from their complimentary base pairs and then cooled to allow primers to connect to the open DNA sequences. This process is repeated again and again to get many copies of the specific DNA strand. In this experiment, the reverse primers used will be in the sequence of AAACTCTTACACTGCATACA and that will accompany to the TTTGAGAATGTGACGTATGT which is the sequence of Colon rectal cancer that is being studied. This occurs on the 22nd chromosome and the missense of the disease comes when the sequence AATGT has the T in the middle is changed to a C which is cancer associated and creates a Protein Change to occur. In this experiment, this sequence will be put in with the reverse primer sequence listed above. Through the PCR process, the primer will attach to the sequence and replicate the DNA sequence. If the cancer sequence is present, the primers will attach and replicate until there are numerous samples of the cancer sequence. If there is no cancer sequence present, the primers will not bond since the sequence will be different and the ending DNA sequence will be the same as the original sequence put in. This will provide a correct detection for the r17879961 SNP. (BONUS points: Use a program like Powerpoint, Word, Illustrator, Microsoft Paint, etc. to illustrate how primers bind to the cancer DNA template, and how Taq polymerases amplify the DNA. Screen-captures from the OpenPCR tutorial might be useful. Be sure to credit the source if you borrow images.) Results (Your group will add the results of your Fluorimeter measurements from Week 4 here)