BME103:T930 Group 10 l2: Difference between revisions
Mikayle Holm (talk | contribs) |
|||
(60 intermediate revisions by 5 users not shown) | |||
Line 12: | Line 12: | ||
{| style="wikitable" width="700px" | {| style="wikitable" width="700px" | ||
|- | |- valign="top" | ||
| [[Image:BME103student.jpg|100px|thumb|Name: | | [[Image:BME103student.jpg|100px|thumb|Name: Nolan Bidese<br>Role: Research and Development]] | ||
| [[Image:BME103student.jpg|100px|thumb|Name: | | [[Image:BME103student.jpg|100px|thumb|Name: Evan Austin<br>Role: Open PCR Thermal Cycler Engineer]] | ||
| [[Image: | | [[Image:Meeeeeeee.jpg|100px|thumb|Name: Aldin Malkoc <br>Role: Open PCR Thermal Cycler Engineer]] | ||
| [[Image:BME103_Group10_MikayleHolm.jpg|100px|thumb|Name: Mikayle Holm <br>Role: Experimental Protocol Planner]] | | [[Image:BME103_Group10_MikayleHolm.jpg|100px|thumb|Name: Mikayle Holm <br>Role: Experimental Protocol Planner]] | ||
| [[Image: | | [[Image:BME103_Group10_Coleen.CF.jpg|100px|thumb|Name: Coleen Fox <br>Role: Experimental Protocol Planner]] | ||
|} | |} | ||
Line 29: | Line 29: | ||
'''System Design'''<br> | '''System Design'''<br> | ||
[[Image:Magnet_Lid.PNG|600px|Lid with highlighted area for magnets]] | |||
[[Image: Hinge_Lid.PNG|600px|Lid with highlighted area for magnets]] | |||
[[Image: Side Panel Lid.PNG|600px|Lid with highlighted area for magnets]] | |||
'''Key Features'''<br> | |||
After using the Open PCR machine, we noticed a few components of the machine that could be improved. The biggest issue we encountered was that of the lid. When placing the tubes into the machine, it was very difficult to unlatch the lid from the base. Additionally, when screwing the heating plate down onto the tubes, it was difficult to tell how much the plate needed to be screwed down. With these problems in mind, we decided to redesign the lid by replacing two of the panels of the lid with plexi-glass and replace the hinge with magnets. By replacing two of the panels with plexi-glass, the user is able to see the heating plate being screwed down onto the tubes. This ensures that proper placement and rids of possible experimental errors. By replacing the hinge with magnets, we eliminate the difficulty experienced with the hinge. Also, placing magnets at the corners of the lid to hold the lid in place allows for greater visibility when adding the tubes to the tray. | |||
'''Instructions'''<br> | |||
'''Assembly Instructions ''' | |||
1. Same procedure following up until lid. | |||
''2. There will be no latch'' | |||
3. Screw in four magnets on machine top and lid at corners. | |||
''4. This will secure lid down to machine.'' | |||
5. Follow instructions to adding side panels to lid with exceptions. | |||
6. ''Exception'': Replace two opposite sides on lid with plexi-glass | |||
'''User Instructions''' | |||
1. Follow all user Instructions with exception. | |||
2. ''Exception 1'': Lid can now come off entirely due to magnetic screws. | |||
''' | ''3. Will make it easier to adding vial tubes.'' | ||
4. ''Exception 2'': Use plexi-glass to see how much to screw down the heating pad. | |||
''5. Will ensure proper fit of heating lid.'' | |||
<!--- From Week 4 exercise ---> | <!--- From Week 4 exercise ---> | ||
Line 60: | Line 90: | ||
'''Materials''' | '''Materials''' | ||
'''For PCR Protocol''' | '''For PCR Protocol''' | ||
{| {{table}} | |||
| align="center"style="background:#f0f0f0;"|'''Supplied in the Kit''' | |||
| align="center"style="background:#f0f0f0;"|'''Volume''' | |||
|- | |||
| *PCR Reaction Mix (a.k.a. GoTaq Mix)|| Amount in kit enough for given experiment | |||
|- | |||
| align="center"style="background:#f0f0f0;"|'''DNA Samples''' | |||
| align="center"style="background:#f0f0f0;"|'''50 μL each''' | |||
|- | |||
| Patients' DNA||DNA of Rabbit Eyeball | |||
|- | |||
| Negative control||Positive Control | |||
|- | |||
| SYBR GREEN1|| | |||
|} | |||
*mix includes Taq DNA Polymerase, MgCl2, dNTP's, Forward and Reverse Primers<br> | |||
{| {{table}} | |||
| align="center" style="background:#f0f0f0;"|'''Supplied by User''' | |||
| align="center" style="background:#f0f0f0;"|'''Amount''' | |||
|- | |||
| Lab Coat||1 or 2 | |||
|- | |||
| PCR machine made of steel with top that snaps||PCR machine must clip closed | |||
|- | |||
| Fluorimeter with built in camera and slides with dots farther apart||12 new glass slides | |||
|- | |||
| Micropipettes||1 box, allow extras for mistakes | |||
|- | |||
| Eppendorf tubes||1 box, at least one for each test | |||
|} | |||
'''PCR Protocol''' | |||
'''PCR Protocol'''<br> | |||
BE CAREFUL NOT TO CROSS CONTAMINATE!!<br> | BE CAREFUL NOT TO CROSS CONTAMINATE!!<br> | ||
1. Label Eppendorf Tubes with 1-17 | 1. Label Eppendorf Tubes with 1-17. Each tube should contain 50 microliters of one of the following substances: <br> | ||
{| {{table}} | {| {{table}} | ||
| align="center" style="background:#f0f0f0;"|'''Test Tube''' | | align="center" style="background:#f0f0f0;"|'''Test Tube''' | ||
Line 110: | Line 166: | ||
| 17||Patient 5, Replicate 3 | | 17||Patient 5, Replicate 3 | ||
|} | |} | ||
[[Image:BME103_Group10_Eppendorf.jpg|400px|Flickr photo by Clss1cr0ck3R]] | |||
2. Use properly labeled micropipette to place 17 samples into 17 properly labeled Eppendorf tubes already containing 50 microliters GoTaq mix. To see contents of GoTaq mix, see materials.<br> | 2. Use properly labeled micropipette to place 17 samples into 17 properly labeled Eppendorf tubes already containing 50 microliters GoTaq mix. To see contents of GoTaq mix, see materials.<br> | ||
3. Place 17 Eppendorf tubes in Open PCR. This PCR machine is made of steel in order to decrease safety hazards, and is able to hold more Eppendorf tubes. Therefore, all 17 Eppendorf tubes fit in this PCR. The top of the PCR machine | 3. Place 17 Eppendorf tubes containing DNA and GoTaq Mix in Open PCR Machine. This PCR machine is made of steel in order to decrease safety hazards, and is able to hold more Eppendorf tubes. Therefore, all 17 Eppendorf tubes fit in this PCR. The top of the PCR machine snaps shut and can be clipped down to be less dangerous. <br> | ||
4. To make up for the more Eppendorf tubes in the PCR machine, each cycle is increased by 2 degrees Celsius, making the Thermal Cycler program: <br> | 4. To make up for the more Eppendorf tubes in the PCR machine, each cycle is increased by 2 degrees Celsius and more power is needed to increase temperature, making the Thermal Cycler program: <br> | ||
Stage One: 1 cycle, 97 degrees Celsius for 180 seconds<br> | Stage One: 1 cycle, 97 degrees Celsius for 180 seconds<br> | ||
Stage Two: 35 cycles, 97 degrees Celsius for 30 seconds, 59 degrees for 30 seconds, 74 degrees Celsius for 30 seconds<br> | Stage Two: 35 cycles, 97 degrees Celsius for 30 seconds, 59 degrees for 30 seconds, 74 degrees Celsius for 30 seconds<br> | ||
Stage Three: 74 degrees Celsius for 180 seconds<br> | Stage Three: 74 degrees Celsius for 180 seconds<br> | ||
Final Hold: 6 degrees Celsius<br> | Final Hold: 6 degrees Celsius<br> | ||
5. | 5. When PCR is complete, proceed to DNA Measurement Protocol<br> | ||
'''DNA Measurement Protocol''' | '''DNA Measurement Protocol'''<br> | ||
BE CAREFUL NOT TO CROSS CONTAMINATE!!<br> | |||
1. With permanent marker, clearly number micropipettes. With permanent marker, number Eppendorf tubes at the top. There should be 17 labeled micropipettes and 17 Eppendorf tubes. <br> | 1. With permanent marker, clearly number micropipettes. With permanent marker, number Eppendorf tubes at the top. There should be 17 labeled micropipettes and 17 Eppendorf tubes. <br> | ||
2. Transfer each sample from PCR Eppendorf tubes to Eppendorf tubes containing 400 microliters of buffer. Get all of the sample into the Eppendorf | 2. Transfer each sample from PCR Eppendorf tubes to labeled (1-17) Eppendorf tubes containing 400 microliters of buffer. Get all of the sample into the Eppendorf tubes. <br> | ||
3. Take specially labeled Eppendorf tube (18) with SYBR GREEN I and using specially labeled micropipette (18) place 2 drops on first two centered drops on fluorimeter slide. These dots are further apart on this fluorimeter slide in order to avoid contamination.<br> | 3. Take specially labeled Eppendorf tube (18) with SYBR GREEN I and using specially labeled micropipette (18) place 2 drops on first two centered drops on fluorimeter slide. These dots are further apart on this fluorimeter slide in order to avoid contamination.<br> | ||
4. Take diluted sample from Eppendorf | 4. Take diluted sample from labeled Eppendorf tubes and place 2 drops on top of sample of SYBR GREEN I drop.<br> | ||
5. Turn light on, place beam so that it is passing through the drop.<br> | 5. Turn light on, place beam so that it is passing through the drop.<br> | ||
6. Take picture with built in camera to avoid variability on smart phone camera settings. <br> | 6. Take picture with built in camera to avoid variability on smart phone camera settings. <br> | ||
7. Use micropipette properly with black strip for waste to discard sample. <br> | 7. Use micropipette properly labeled with black strip for waste to discard sample. <br> | ||
8. Repeat 3-7 for all samples (Eppendorf tubes 1-17), the DNA of rabbit eyeball (Eppendorf tube 19), and scintillation vial. <br> | 8. Repeat 3-7 for all samples (Eppendorf tubes 1-17), the DNA of rabbit eyeball (Eppendorf tube 19), and scintillation vial. <br> | ||
9. Generate pictures in ImageJ to analyze results. <br> | 9. Generate pictures in ImageJ to analyze results. <br> | ||
Line 139: | Line 198: | ||
'''Background on Disease Markers''' | '''Background on Disease Markers''' | ||
The prostate is a gland in the male reproductive system located just below the bladder. It is about the size of a walnut and surrounds part of the urethra. The prostate gland helps to control urinary and sexual functions that are associated with the reproductive system.[http://www.cancer.gov/cancertopics/pdq/treatment/prostate/Patient] Risk Factors for prostate cancer are age, race, and family genetics of prostate cancer. The marker being used is rs137852593 [http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=137852593] This SNP is associated with a defect in a protein in the prostate that may or may not cause cancer in the prostate. It is located on the X chromosome and the mutated protein goes from R [Arg] ⇒ L [Leu]. | |||
Leukemia is a type of cancer that affects the blood and bone marrow. The disease develops when blood cells produced in the bone marrow grow out of control. An estimated 44,600 new cases of leukemia are expected to be diagnosed in the United States in 2011. [http://www.lls.org/#/diseaseinformation/leukemia/] The marker being used for this is rs111033629.[http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=111033629] The SNP is associated with a defect in a protein in bone marrow. It is located on the X chromosome and the mutated protein goes from M [Met] ⇒ I [Ile]. | |||
Line 147: | Line 206: | ||
<!--- Include the sequences of your forward and reverse primers. Explain why a disease allele will give a PCR product and the non-disease allele will not. ---> | <!--- Include the sequences of your forward and reverse primers. Explain why a disease allele will give a PCR product and the non-disease allele will not. ---> | ||
5'ACAAAGGAAAAAGTTCT'''ATT'''TC3' | |||
ATG ⇒ ATT The change in mutated protein | |||
Reverse Primer: TGTTTCCTTTTTCAAGATAAAG | |||
5'CAACTTACACTGGACGTCCAGA3' | |||
CGC ⇒ CTC change in the mutated protein | |||
Reverse Primer: GTTGAATGTGACCTGCAGGTCT | |||
'''Illustration''' | '''Illustration''' | ||
<!--- Include an illustration that shows how your system's primers allow specific amplification of the disease-related SNP ---> | <!--- Include an illustration that shows how your system's primers allow specific amplification of the disease-related SNP ---> | ||
[[Image:SNP.jpg]] | |||
[http://www.sciencedirect.com/science/article/pii/S0167701206002247] | |||
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | <!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | ||
|} | |} |
Latest revision as of 18:45, 29 November 2012
BME 103 Fall 2012 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
Key Features
2. There will be no latch 3. Screw in four magnets on machine top and lid at corners. 4. This will secure lid down to machine. 5. Follow instructions to adding side panels to lid with exceptions. 6. Exception: Replace two opposite sides on lid with plexi-glass
2. Exception 1: Lid can now come off entirely due to magnetic screws. 3. Will make it easier to adding vial tubes. 4. Exception 2: Use plexi-glass to see how much to screw down the heating pad. 5. Will ensure proper fit of heating lid.
ProtocolsMaterials For PCR Protocol
1. Label Eppendorf Tubes with 1-17. Each tube should contain 50 microliters of one of the following substances:
2. Use properly labeled micropipette to place 17 samples into 17 properly labeled Eppendorf tubes already containing 50 microliters GoTaq mix. To see contents of GoTaq mix, see materials. DNA Measurement Protocol 1. With permanent marker, clearly number micropipettes. With permanent marker, number Eppendorf tubes at the top. There should be 17 labeled micropipettes and 17 Eppendorf tubes. Research and DevelopmentBackground on Disease Markers The prostate is a gland in the male reproductive system located just below the bladder. It is about the size of a walnut and surrounds part of the urethra. The prostate gland helps to control urinary and sexual functions that are associated with the reproductive system.[1] Risk Factors for prostate cancer are age, race, and family genetics of prostate cancer. The marker being used is rs137852593 [2] This SNP is associated with a defect in a protein in the prostate that may or may not cause cancer in the prostate. It is located on the X chromosome and the mutated protein goes from R [Arg] ⇒ L [Leu]. Leukemia is a type of cancer that affects the blood and bone marrow. The disease develops when blood cells produced in the bone marrow grow out of control. An estimated 44,600 new cases of leukemia are expected to be diagnosed in the United States in 2011. [3] The marker being used for this is rs111033629.[4] The SNP is associated with a defect in a protein in bone marrow. It is located on the X chromosome and the mutated protein goes from M [Met] ⇒ I [Ile].
5'ACAAAGGAAAAAGTTCTATTTC3' ATG ⇒ ATT The change in mutated protein Reverse Primer: TGTTTCCTTTTTCAAGATAAAG 5'CAACTTACACTGGACGTCCAGA3' CGC ⇒ CTC change in the mutated protein Reverse Primer: GTTGAATGTGACCTGCAGGTCT Illustration |