BME103:T930 Group 12

BME 103 Fall 2012	Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help
OUR TEAM Name: Philip Remick Role(s) Name: David Tze Role(s) Name: Ryan Magnuson Role(s) Name: Nathan Moore Role(s) Name: Divya Amrelia Role(s) LAB 1 WRITE-UP (Please finish by 11/7/2012) Initial Machine Testing The Original Design (Add image of the full OpenPCR machine here, from the Week 3 exercise. Write a paragraph description for visitors who have no idea what this is) Experimenting With the Connections When we unplugged the LCD plate from the Open PCR circuit board, the display of the machine turned off (it stopped sending data to the display). The circuit board sends electricity through the wires, therefore if it is not plugged into the circuit board, it will not work. When we unplugged the white wire that connects the Open PCR circuit board to the 16 tube PCR block, the machine would not record the temperature. This defeats the whole purpose of the machine as it needs to heat the tubes to the specific temperatures. Test Run On October 25, 2012, we experimented with the Open PCR. The experience was not pleasant as the machine took an hour and forty minutes to finish the experiment. The time estimate was also incorrect as it fluctuated. Fortunately, the experiment was a success as the machine finished the testing, revealing whether the DNA contained mutations. (Write the date you first tested Open PCR and your experience(s) with the machine) Protocols Polymerase Chain Reaction (Add your work from Week 3, Part 1 here) Flourimeter Measurements (Add your work from Week 3, Part 2 here) Research and Development Specific Cancer Marker Detection - The Underlying Technology (Add a write-up of the information discussed in Week 3's class) (BONUS points: Use a program like Powerpoint, Word, Illustrator, Microsoft Paint, etc. to illustrate how primers bind to the cancer DNA template, and how Taq polymerases amplify the DNA. Screen-captures from the OpenPCR tutorial might be useful. Be sure to credit the source if you borrow images.) PCR or polymerase chain reactions are used to identify genes by making copies of specific DNA sequences and amplifying the reactions. There are a variety of applications for PCR including DNA cloning, the diagnosis of hereditary diseases, and the identification of genetic fingerprints. In this case, PCR was used to diagnose a gene known to predict a certain hereditary disease. PCR uses thermal cycling in which the DNA is amplified, generating thousands to millions of copies of the particular gene. Before the process is described, here is some terminology to know. •Template DNA- the sequence being detected. •Primers- Initiate the start site for DNA replication. •Taq polymerase- an enzyme that grabs bases, and matches them to the DNA strand, replicating the strand. •Magnesium Chloride (MgCl2)- a cofactor that binds to Taq and helps it work more efficiently. • dNTP’s -the individual nucleotides floating in the sample tube that will act as building block subunits to be used by the Taq. The process is as follows: •The sample is heated to 95 degrees Celsius to separate strands and expose bases. •The primers are added to the sample and it is cooled to 57 degrees Celsius so that the separated DNA strands try to reconnect. The primers will bind to the strands in the phase preventing them from reconnecting. •The sample is then heated to 72 degrees Celsius and Taq enzymes attach and start replication, with the help of magnesium chloride to help the enzymes work more efficiently. •The cycle is repeated many times The r17879961 sample is a cancer causing polymorphism prevalent in homo sapiens. It is located in chromosome 22 and is identified by an allele change of ATT → ACT. This missense causes a residue change of I [Ile] ⇒ T [Thr]. Here is the sequence surrounding the mutation: AACTCTTACAC/TTGCATACAT TTGAGAATGTG/AACGTATGTA To detect this sequence using open PCR, the primers must first be constructed. In this case, the reverse primer is going to be AACTCTTACACTGCATACAT, and the forward primer is going be TGGTATAAGACATTCCTGT, located 200 base pairs to the left and would attach to the opposite strand as the reverse primer. The strand needs to be at least 200 base pairs long so that it can be easier detected if the results are positive. If the sample produces positive results, it means that the r17879961 gene is present, so the primers will bind to this gene, replicating exponentially and producing thousands to millions of copies of DNA. If the sample being tested gives us negative results and does not contain this sequence, there will only be around 30 replicated strands of DNA, rather than millions copies, since the primers won’t bind to the gene. A green fluorescent dye is usually used to identify whether or not the sample is positive or negative. The affected gene is checkpoint kinase 2, and in a study of 180 patients the mutation has been shown to occur in 1.1% of population, while the normal gene occurs in 98.9% of the population. The mutations have been linked most closely to prostate and colorectal cancer, but are also associated with Li-Fraumeni syndrome, breast cancer, sarcomas, and brain tumors. According to a study in Finland, the gene was observed in 7.8% of patients with colorectal cancer, and 5.3% of the healthy population (Kilpivaara et al., 2006). Results (Your group will add the results of your Fluorimeter measurements from Week 4 here)