BME103:T930 Group 13 l2: Difference between revisions
Line 105: | Line 105: | ||
<font size="4">'''DNA Measurement Protocol'''</font> | <font size="4">'''DNA Measurement Protocol'''</font> <br> | ||
1. label each pipette bulb, using sharpie, with the sample name it will be used for (ex: "c+" or "1-3" as in patient 1-replicate 3)<br> | |||
2. label each Eppendorf tube, using sharpie, with the same name corresponding to the pipette <br> | |||
3. using only one designated pipette per sample transfer the each sample into separate Eppendorf tubes filled with 400mL of buffer solution. make sure to label the buffer tube with the corresponding sample name (ex: "c+" or "1-2")<br> | |||
4. to set up fluorimeter, slide one glass slide into slit with the gritty side facing up and slide the glass so that the light is aligned between the first two holes<br> | |||
5. using pipette designated for sample , place one drop on each of the two holes on the glass slide <br> | |||
6. using pipette designated for sybr green solution, place two drops in between the two drops of sample, this should create one big drop of liquid<br> | |||
7. realign the light to make sure it is going through the drop of liquid <br> | |||
8. place smart phone is phone holder and set in front of fluorimeter making sure camera can clearly see drop of liquid <br> | |||
9. place black box over phone in holder and flourimeter to darken area <br> | |||
10. press screen camera on the drop to focus camera <br> | |||
11. take picture of drop covering area from light as best as possible<br> | |||
12. once picture is taken, make sure to write down the name of the picture in the phone as it corresponds to the sample in a chart<br> | |||
13. using a pipette designated for waste, suck up the drop, squeeze into waste cup, and slide glass so that light is between the next two holes<br> | |||
14. repeat steps 5 through 13 for all patients samples and controls, keep in mind that each slide can run five samples so glass slides must be changed every 5 samples<br> | |||
15. | |||
==Research and Development== | ==Research and Development== |
Revision as of 22:19, 28 November 2012
BME 103 Fall 2012 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||
THE A TEAMLAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski. System Design Key Features Instructions ProtocolsMaterials
PCR Protocol
Research and DevelopmentBackground on Disease Markers
Cystic fibrosis is a disease that can be passed on down genetically along the familial line. The disease causes a build up of thick mucus on the inside of the lungs, digestive tract and other parts of the body. Cystic Fibrosis is the most common chronic lung disease to effect children and young adults and is usually diagnosed by the age of two; however, there are weaker strains of the disease that often go un-diagnosed until the age of 18 or later. The disease is recessive so to suffer the disease one must have the gene from both parents. The disease is life-threatening, the mucus builds up and can eventually suffocate the victim. Around 1 in 29 Caucasians of middle European dissent suffer from cystic fibrosis, this is the most susceptible group to this disease. One such SNP which signals for a susceptibility to Cystic Fibrosis is the [A/G] swap changing the codon from TGG ⇒ TGA. This change has been recorded in two patients suffering from cystic fibrosis the swap occurs at nucleotide 302 in exon 3 converting codon 57 from TGG (trp) to TGA (stop). More information can be found: http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=121909025
The primers must be built around the sequence CGTCTCTAC[T/C]CTATCTCTC with the thymine swapped for the cytosine giving the primers: Reverse primer: 3' CGTCTCTTACTCTATCTCTC 5' Forward primer: 5' AAATATCTGGCTGAGTGTTT 3' These primers are 150 bp apart so as to allow the PCR reaction to occur faster, shortening the 30 seconds required per temperature cycled to 10 seconds per cycle.
General PCR is very similar to our new version of PCR. The only difference is that our primers are only fifteen base pairs long and will be only 150 base pairs apart. So each copied segment in this illustration is 150 base pairs long and the primers look like the first illustration. |