BME103:T930 Group 14 l2: Difference between revisions
Line 98: | Line 98: | ||
'''PCR Protocol''' | '''PCR Protocol''' | ||
*Procedure: | * Procedure: | ||
#Obtain 6 DNA samples, 2 subjects with 3 samples from each subject and clearly label each test tube. Also include 2 extra tubes, a positive and a negative control | ** Preparing the DNA samples | ||
#Add 50 μL of the PCR reaction mixture to each 50 μL sample of patient DNA. The PCR reaction mix is composed of: | # Obtain 6 DNA samples, 2 subjects with 3 samples from each subject and clearly label each test tube. Also include 2 extra tubes, a positive and a negative control | ||
##0.2 μL Template DNA (20 ng) | # Add 50 μL of the PCR reaction mixture to each 50 μL sample of patient DNA. The PCR reaction mix is composed of: | ||
##1.0 μL 10 μM forward primer | ## 0.2 μL Template DNA (20 ng) | ||
##1.0 μL 10 μM reverse primer | ## 1.0 μL 10 μM forward primer | ||
##50.0 μL GoTaq master mix | ## 1.0 μL 10 μM reverse primer | ||
###2X Colorless GoTaq® Reaction Buffer( pH 8.5) | ## 50.0 μL GoTaq master mix | ||
###400μM dATP | ### 2X Colorless GoTaq® Reaction Buffer( pH 8.5) | ||
###400μM dGTP | ### 400μM dATP | ||
###400μM dCTP | ### 400μM dGTP | ||
###400μM dTTP | ### 400μM dCTP | ||
###3mM MgCl<sub>2</sub>. | ### 400μM dTTP | ||
##47.8 μL dH<sub>2</sub>O (A total volume of 100.0 μL) | ### 3mM MgCl<sub>2</sub>. | ||
#The eight prepared samples | ## 47.8 μL dH<sub>2</sub>O (A total volume of 100.0 μL) | ||
# | # The eight prepared samples should be placed into a refrigerator until they are placed into the Open PCR Machine. | ||
## 90ºC for 30 seconds | ** Setting up the Open PCR Machine | ||
## 57ºC for 30 seconds | # The Open PCR Machine must be plugged in and connected to a computer through a USB port and cable. | ||
## 72ºC for 30 seconds | # The PCR machine holds 16 samples, only 8 of the wells will be used in this situation. Place the wells horizontally to the lid hinge, in the inner well rows. | ||
# Close the lid and ensure that it snaps down completely | |||
# Once the machine is turned on and plugged into the computer, with software already downloaded, the test should be programed as follows | |||
## 30 cycles must be run of the following pattern | |||
### 90ºC for 30 seconds | |||
### 57ºC for 30 seconds | |||
### 72ºC for 30 seconds | |||
Revision as of 21:04, 28 November 2012
BME 103 Fall 2012 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | ||||||||||||||||||||||||||||||
OUR TEAMLAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
What changes are we making to our system? Will have to take another picture with changes before class!
ProtocolsMaterials
Research and DevelopmentBackground on Disease Markers ALZHEIMER'S DISEASE (AD) As it turns out, Alzheimer's Disease is a uniquely diverse disease, as it has many different genetic mutations that can cause early-onset Alzheimer's. A brief background before we start. Early-onset AD is the least common form of AD, as it only occurs in 5% of individuals who have the disease, but it is the only type of AD that comes almost completely from inherited genetic traits. The problem comes in when the new gene sequence causes a change in a protein made, which generates harmful amyloid plaques (the driving force of the disease). Late-onset AD occurs in the other 95% and is a combination of lifestyle, genetic, and environmental factors. Most of info found on: (http://www.stanford.edu/class/gene210/files/projects/Gen210AlzheimersDisease.pdf)
Primer Design ALZHEIMER'S DISEASE (AD) Because there are many different variations of genetic early-onset AD that can occur, we chose to focus on the sequence rs17517621, which causes a G to change to an A. AAATCTTTTTG[G/A]CAAATTTG is the specific primer sequence that we located for this disease. Following the DNA strand to the left, the specific primer for this type of genetic AD variation was found. According to Dr. Haynes, only 150 BP to the left are needed, so we only went 150 BP to help increase the speed of the PCR. The DNA primer sequence is GACAATTGCTAAGTGTAACA (http://www.ncbi.nlm.nih.gov/snp?term=17517621), which can be used, as discussed before, to help identify DNA with this genetic variation present. And the reverse would be CTGTTAACGATTCACATTGT. Forward Primer:GACAATTGCTAAGTGAACA Reverse Primer:ACAAGTGAATCGTTAACAG Other common variances of AD occur in rs429358 and rs7412 (which involve changes in C and T), but the primer and sequence is only needed for rs17517621. As discussed in the last lab, a diseased allele will give a positive result in the PCR because only this specific primer can bind to that specific DNA sequence. So if the disease is present, the primer will bind and replicate the DNA exponentially, resulting in a positive. If the disease is not present, on the other hand, the primer will have no chance to bind, thus giving a negative result.
|