BME103:T930 Group 17

BME 103 Fall 2012	Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help
OUR TEAM Doug Steinhauff (R&D Scientist) File:CarsonBridgers.jpg Carson Bridgers (DNA Measurement Operator and PCR machine operator) Kathleen Farrell (Protocol and Procedures) Kaleia Kramer (ImageJ Software Processor and PCR machine operator) LAB 1 WRITE-UP The Original Design This is an Open PCR Machine. An Open PCR Machine can rapidly duplicate DNA, or in other terms amplify it, as well as attach marker to make traits such as cancer visible. PCR stands for polymerase chain reaction. It works by heating up samples to first denature DNA and create single stranded DNA. Then it cools to allow the primer to attach and replicate the DNA. The open PCR machine starts with an initialization step where the temperature rapidly increases to 95 degrees Celsius to create a hot-start for DNA polymerization that requires heat activation. The second step is to denature the protein, where the first cycling event heats the DNA strands at a temperature of 95 degrees Celsius for 30 seconds to melt the DNA template through the disruption of hydrogen bonding between paired bases, effectively splitting the double stranded helix into two single strands of DNA. The third step is the annealing step where the temperature is rapidly lowered to around 50 degrees Celsius to allow for the annealing of primers. The polymerase then binds to the hybrid of primers with the template to begin DNA formation. Then begins the elongation step, which differs depending on the polymerase used; typically the optimum temperature is around 75 degrees Celsius. During the elongation process, DNA polymerase synthesizes a complementary new strand of anti-parallel DNA. The amount of time required for elongation differs depending on the DNA polymerase used as well as the length of the amplified DNA fragments being used. On average, DNA polymerase amplifies at a rate of one thousand bases per minute. Next is the final elongation step where the temperature is held around 75 degrees Celsius to ensure that the DNA strand is fully elongated and will generally hold for around five minutes. Finally there is an end hold temperature that keeps the reaction at a steady temperature (between four and fifteen degrees) until the amplified DNA is ready to be utilized and further studied. This is the LCD monitor and the PCB board The LCD monitor serves the purpose of informing the user of the temperature of the lid as well as the temperature of the samples. This serves as a visual verification that the program is running according to plan and follow along with the timing and temperatures involved in Open PCR experiments. This is the Heat Sink and Fan In this image the heat sink and fan have been isolated from the machine. These are used to keep the machine cool and running. When the cooling cycles begin the fan will increase speed to gradually decrease the temperature. This is the Open PCR Circuit Board In this image the circuit board has been isolated from the machine. The circuit board is used to support all of the electronic components. All of the wires connecting the fan, the LCD monitor, power supplies, and the heat sink all of which work together to ensure the functionality of the machine This is the PCR machine In this image the power supply has been isolated from the machine. The power supply provides energy for all of the components in the PCR Machine. This is the Sample Holder In this image the top has been moved aside so that the sample holder is visible. The sample holder keeps the samples in place while the PCR machine cycles. The heated lid tightens so that the inside of the lid will press against the samples without crushing them to ensure that they are heated quickly and evenly. Experimenting With the Connections When the LCD Monitor was unplugged from the Open PCR Circuit Board the monitor lost power. When we unplugged the white wire that connects the Open PCR Circuit Board to the Sample Holder/Heating Block, the LCD monitor incorrectly displayed the temperature. Instead of displaying the correct temperature of 25 degrees Celsius it displayed a temperature of -40 degrees Celsius. Test Run We first tested our PCR machine on 10/18/12. The machine malfunctioned due to lack of heat management and would not cool. It was later discovered that several internal wires were disconnected. A different machine was procured, tested, and found to work. This new machine was used for all of the experiments. Protocols Polymerase Chain Reaction Part I: Description of PCR: The Polymerase Chain Reaction uses multiple heating and cooling cycles to target and amplify a specific piece of DNA in a sequence. This is useful because it allows for millions of copies of the specific DNA piece to be copied, which yields an abundant amount of samples for the person examining the DNA for disease, mutation, or etc. We used three stages for this experiment. Stage one had one cycle heating to 95 degrees Celsius for three minutes, which resulted in the DNA unwinding to a single strand. Stage 2 consisted of 35 cycles. Each cycle of stage 2 was: held at 95 degrees Celsius for 30 seconds (DNA continues to unwind), cooled to 57 degrees Celsius for 30 seconds (primer begins to bond), and re-heated to 72 degrees Celsius for 30 seconds (extension of new copy begins). Stage 3 was held at 72 degrees Celsius for 3 minutes in order to finish the extension of the DNA copying. Part II: Procedure describing amplification of patient DNA: 1. Gather all components for PCR reaction (template DNA, primers, Taq polymerase, magnesium chloride, and dNTP’s). 2. Place template DNA into a test tube. 3. Add Primer 1 to the test tube. It will attach to the first binding site on one end of the template DNA. 4. Add Primer 2 to the test tube. It will attach to the second binding site on the opposite side of the template DNA. 5. Add nucleotides (dNTP’s) to the test tube. These free floating nucleotides will be used when extending the template DNA. 6. Add Taq polymerase to the test tube. This enzyme will bind to the specific priming site and replicate DNA at the end of the strand by adding nucleotides. 7. Add Magnesium Chloride, a cofactor that will bind to Taq polymerase and allow for greater efficiency, to the test tube. 8. Download the Open PCR software onto the computer. 9. Plug the Open PCR machine into an electrical outlet. 10. Connect the machine to the computer using the USB cable. 11. Place empty PCR tubes into the machine. Close the lid and tighten the screw until it touches the tops of the tubes. Do not over-tighten! 12. Create a new program on the machine that follows: Stage one: 1 cycle, 95 degrees Celsius for 3 minutes; Stage two: 35 cycles: 95 degrees Celsius for 30 seconds, 57 degrees Celsius for 30 seconds, and 72 degrees Celsius for 30 seconds; Stage three: 72 degrees Celsius for 3 minutes; and a final hold at 4 degrees Celsius. 13. Start the new program. 14. Wait for program to run to completion. Part III: List of all PCR components in master mix: 1. GoTaq® Colorless Master Mix, 2X 2. Upstream Primer, 10 μM 3. Downstream Primer, 10 μM 4. DNA template 5. Nuclease-Free Water Part IV: Table listing reagent and volume used: Reagent Volume Template DNA (20 ng) .2μL 10 μM Forward Primer 1.0 μL 10 μM Reverse Primer 1.0 μL GoTaq Master Mix 50.0 μL dH2O 47.8 μL Total Volume 100.0 μL Part V: Patient Sample Description: Patient ID Sex Age 22345 Male 65 33167 F 23 Flourimeter Measurements Part 1: Photos of Assembly: Part II: Assembly Procedure: 1. Obtain a fluorimeter box that contains crucial materials for the fluorimeter assembly. 2. Set up the box "upside-down" so that most of the light will be blocked from the inside. 3. Place the cell phone in the docking area. 4. Place the glass slide over the black container that marks designated areas for the water droplets with black dots. 5. Place the glass slide with container on top of black shelving. Part III: Saving Images Procedure: 1. Set up the fluorimeter. 2. Take picture of the specimen (droplet) using a cell phone camera. 3. E-mail picture to computer that contains Image J software. 4. Save image to computer and upload into Image J. 5. Analyze specimen by "drawing" a circle that outlines the droplet from the image. 6. Save data in Word Excel. 7. Repeat steps 2-6 for all images. Research and Development Specific Cancer Marker Detection - The Underlying Technology The specific DNA sequence that we are investigating is the r17879961 cancer associated sequence. This point mutation will change a thymine in a normal DNA strand to a cytosine in a mutated DNA strand. This mutation will result in an amino acid change of isoleucine to threonine when translated into an amino acid sequence. The primer designed for this single DNA mutation that causes cancer is able to bind to the template strand only if the mutation for cancer is present, which will allow for TAQ polymerase to extend the DNA. If the mutation is not present then the primer cannot bind and will therefore not be able to be extended resulting in a negative PCR reaction as amplification will not occur. The primers that we will use for this specific PCR have a sequence of AAACTCTTACACTGCATACA and CAGGACAAATTTCCTCCTAT. Bayes's Theorem: p(A|X) = [ p(X|A)*p(A)] / [ P(X|A)*p(A) + p(X|~A)*p(~A) ] This theorem demonstrates the probability of some event happening based on a certain observation. A is the given phenomenon, while X is some observation of the phenomenon. In our case the phenomenon was either positive for cancer or negative for cancer and the observation of the phenomenon was weather it was positive or negative. Therefore, we had two equations derived from this model: PPV = TP/(TP+FP) PPV is positive prediction value TP is true positive FP is false positive This gives you the probability that someone actually does have cancer. and NPV = TN/(TN + FN) NPV is negative prediction value TN is true negative FN is false negative This gives you the probability that someone does not have cancer. Results Water Calf Thymus Original Recorded ImageJ Data Sample Name Area Mean Raw Integrated Density Integrated Density PCR: Water Trial (drop) 22588 90.925 2053819 2053819 PCR: Water Trial (background)l 24711 27.044 668287 668287 PCR: Negative Control (drop) 25608 88.317 2261618 2261618 PCR: Negative Control (background) 24819 22.568 560108 560108 PCR: Calf Thymus (Positive) (drop) 24961 118.833 2966194 2966194 PCR: Calf Thymus (Positive) (background) 22860 122.817 2807604 2807604 PCR: Patient 1 ID 22345, rep 1 (drop) 21232 80.643 1712217 1712217 PCR: Patient 1 ID 22345, rep 1 (background) 24577 3.07 75458 75458 PCR: Patient 1 ID 22345, rep 2 (drop) 30988 92.088 2853614 2853614 PCR: Patient 1 ID 22345, rep 2 (background) 28180 31.919 899464 899464 PCR: Patient 1 ID22345#, rep 3 (drop) 28878 84.477 2439513 2439513 PCR: Patient 1 ID 22345, rep 3 (background) 31522 7.076 223042 223042 PCR: Patient 2 ID 33167, rep 1 (drop) 20632 111.722 2305058 2305058 PCR: Patient 2 ID 33167, rep 1 (background) 20088 97.416 1956900 1956900 PCR: Patient 2 ID 33167, rep 2 (drop) 13428 128.761 1728999 1728999 PCR: Patient 2 ID 33167, rep 2 (background) 13082 133.966 1752545 1752545 PCR: Patient 2 ID 33167, rep 3 (drop) 23100 102.688 2372096 2372096 PCR: Patient 2 ID 33167, rep 3 (background) 23362 124.369 2905517 2905517 Supporting Analysis Sample Name Integrated Density (drop) Integrated Density (background) Integrated Density with Subtracted Background DNA μg/mL Conclusion PCR: Water Trial 2053819 668287 1385532 none Negative PCR: Negative Control 2261618 560108 1701510 0.3349 Negative PCR: Positive Contro: Calf Thymus 2966194 2807604 10158590 2.0000 Calf Thymus Positive PCR: Patient 1 ID 22345, rep 1 1712217 75458 1636759 0.3222 Negative PCR: Patient 1 ID 22345, rep 2 2853614 899464 1954150 0.3847 Negative PCR: Patient 1 ID 22345, rep 3 2439513 223042 2216471 0.4364 Negative PCR: Patient 2 ID 33167, rep 1 2305058 1956900 348158 0.685 Negative PCR: Patient 2 ID 33167, rep 2 1728999 1752545 -23546 -0.0046 Negative PCR: Patient 2 ID 33167, rep 3 2372096 2905517 -533421 -0.1096 Negative Final Results Sample Integrated Density DNA μg/mL Conclusion PCR: Water Trial 1385532 None Negative PCR: Negative Control 1701510 0.3349 Negative PCR: Positive Contro: Calf Thymus l 10158590 2.0000 Positive PCR: Patient 1 ID 22345, rep 1 1636759 0.3222 Negative PCR: Patient 1 ID 22345, rep 2 1954150 0.3847 Negative PCR: Patient 1 ID 22345, rep 3 2216471 0.4364 Negative PCR: Patient 2 ID 33167, rep 1 348158 0.6850 Negative PCR: Patient 2 ID 33167, rep 2 -23546 -0.0046 Negative PCR: Patient 2 ID 33167, rep 3 -533421 -0.1096 Negative Further Explanations and Work File:BME103 OpenPCR table.xls The attached link is a downloadable copy of the above tables which serve to further show additional planning, work and calculations. KEY Sample = Provides an identification number or some sort of context supporting the information provided Area = Area of the water droplet measured in pixels Mean = The average amount of grey area pixels in the selected region of the water droplet Integrated Density = The area multiplied by the mean Raw Integrated Density = The calculated sum of all the pixels provided in the selected region DNA μg/mL = By incorporating knowledge of the integrated density and the DNA concentration of the positive control, the DNA concentration of each can be calculated using the following formula: x = 2.0 * sample INTDEN with background subtracted / calf thymus INTDEN with background subtracted Conclusion = If the DNA concentration was > 1μg/mL then the sample is considered to exhibit a positive result. If the DNA concentration was < 1μg/mL then the sample is considered to exhibit a negative result or no signal.