BME103:T930 Group 3 l2

BME 103 Fall 2012	Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help
OUR TEAM Name: Lekha Anantuni Role: R&D Name: Rohan Kumar Role(s) Name: Kyle Stoneking Role(s) Name: Austin Cuaderno Role(s) Name: Josh Eger Role(s) LAB 2 WRITE-UP Thermal Cycler Engineering Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski. System Design Key Features Instructions Protocols Materials Supplied in the kit Amount Open PCR Machine 1 Template DNA (20 ng) 0.2 μL Fluorimeter 1 Open PCR Software 1 Image J Software 1 Glass Slides 50 Supplied by User Amount Pippets 8 Computer 1 10 μM reverse primer 1.0 μL 10 μM reverse primer 1.0 μL GoTaq master mix 50.0 μL dH2O 47.8 μL PCR Protocol 1.) Get 3 replicate DNA samples each from two patients and one positive control and negative control sample for a total of 8 samples. Mix each of your samples with Taq DNA polymerase, MgCl2, dNTP's, forward primer and reverse primer. Each sample should be about 50 micro liters. 2.)Label 8 empty PCR tube with unique labels that correspond to their respective DNA samples. 3.)Using one pipette per sample, to avoid contamination, transfer the PCR reaction mix to PCR tubes. 4.)Then place the samples into the PCR machine 5.)Set the PCR program to three stages. Stage one: 1 cycle, 95 degree Celsius for 3 minutes. Stage 2: 35 cycles, 95 degrees Celsius for 30 seconds, 57 degrees Celsius for 30 seconds, 72 degrees Celsius. Stage three: 72 degrees Celsius for 3 minutes and then hold at 4 degree Celsius DNA Measurement Protocol Research and Development Background on Disease Markers 1.) The amyloid Beta precursor protein for Alzheimer's - rs63751263 (http://omim.org/entry/104760#0008) AGACGGAGGAGATCTCTGAAGTGAAG [A/C] TGGATGCAGAATTCCGACATGACTC 2.) Ubiquitin-like Modifier-activating enzyme for Spinal muscular atrophy - rs80356547(http://omim.org/entry/314370#0002) GATGGCGTGGCCAATGCCCTGGACAA [C/T] GTCCATGCCCGTCAGTTTGGAGGCG Primer Design 1.) Forward primer: CTTC[G]ACCT Reverse primer: TCCA[G]CTTC 2.) Forward primer: TGTT[A]CAGG Reverse primer: GGAC[A]TTGT Illustration