BME103:T930 Group 7

BME 103 Fall 2012	Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help
OUR TEAM Name: Wesley Karlin Role(s) Experimental Protocol Planner Name: Lauren Edwards Role(s) Experimental Protocol Planner Name: Raphael Pascua Role(s) Machine Engineers Name: Elyse Candell Role(s) Machine Engineers Name: Katey Hemphill Role(s) Research and Design Scientist LAB 1 WRITE-UP Initial Machine Testing The Original Design Description: The OpenPCR Machine creates many copies of a small strand of DNA. In order to duplicate these DNA strands the PCR Machine must use many different temperatures during denaturing, annealing and extension. Denaturing is where the two strands of DNA separate. Annealing is where the DNA primer binds to the separate strands. Extension is when Taq Polymerase copies the DNA strands. Experimenting With the Connections When we unplugged the LCD screen from the OpenPCR circuit board, the machine's LED light no longer worked. When we unplugged the white wire that connects the OpenPCR circuit board to the main heating block, the temperature reading on the LCD screen changed. Test Run: The date the machine was used was on Thursday October 24th, 2012. We had machine number 13. The team's experience with the device was as follows: Pro's: Lightweight Silent User Friendly Great Software (it was very easy to use) Con's: Took too long to complete its task Needed a computer Hard open the lid Not Aesthetically Pleasing Flammable (Wood + Extreme Heat=A Bad Situation Waiting to Happen.) Protocols Polymerase Chain Reaction PCR, or Polymerase Chain Reaction, is a process used to make copies of the same DNA sequences. This process includes a template DNA strand, which serves as the DNA that will be replicated. Primers are also needed to artificially synthesize the DNA strand. Taq polymerase then matches base-pairs, thus replicating the DNA. Magnesium Chloride is also needed because it binds to Taq, allowing it to function. Finally, dNTP’s are the nucleotides, A, T, C, and G, that are used to make the new DNA. The process includes the following steps: 1. Heat Denaturation: The heating of DNA to 95 degrees celsius allowed for the separation of the two strands of DNA. The nucleotides lose their base pair partners as the DNA is separated into a positive and a negative strand. 2. Annealing: The DNA now undergoes cooling of 57 degrees celsius to assist the process of annealing. Two primers are necessary for DNA replication as it's the primers that identify the specific targeted strand of DNA. Binding to the complementary sequence, the primers begin to produce the replication that's desired. 3. Extension: To finish off the first cycle of PCR, the temperature is once again raised to 72 degrees celsius. The enzyme Taq DNA polymerase then creates the new DNA strands by making each single strand now a double strand using the complementary sequences produced in annealing. The conclusion of these three steps is the production of two new DNA strands that are the replicate of the original strand. PRC Master Mix Components: - Bacterially derived Taq DNA polymerase - dNTPs - Magnesium Chloride - Reaction buffers Reagent Volume Template DNA (20ng) 0.2 uL 10 uM forward primer 1.0 uL 10 uM reverse primer 1.0 uL GoTaq master mix 50.0 uL dH2O 47.8 uL Total Volume 100 uL The Samples There were eight samples that were ran PCR on during this experiment. This included a positive control cancer DNA template and a negative control without a DNA template. Patient 1, a 57 year old male with an ID of 58515, had three samples tested on and patient 2, a 59 year old female with an ID of 19033, also had three samples tested on. Flourimeter Procedures The Flourimeter is a device that detects flourescence, when a molecue produces a light after being excited by another light with a shorter wavelength. The process is completed through the following steps: 1. To keep the patient samples and solutions separate, 10 pipettes were labeled at the top with a permament marker with their corresponding sample 2. Take 10 Eppendorf tubes containing 400mL of buffer and label them with the permament marker to their corresponding sample 3. Next, transfer the patient sample into the assigned Eppendorf tube with an appropriate pipette. For example, Patient Sample A will be transferred into Eppendorf Tube A while using Pipette A only. This prevents the samples from contaminating each other. 4. Using the SYBR Green and its assigned pipette, two drops are placed in the first two center circles on the glass slide with the rough, superhydrophobic, Teflon layer 5. Then two drops of a patient sample were placed on top of the SYBR Green drops on the slide 6. With the SYBR Green mixed with the patient sample on the slide, the slide was positioned so that the blue ray of light would pass through the SYBR Green and patient sample 7. Afterwards, the smarphone operator took a picture of the slide (as seen below) under the following conditions: an inactive flash, iso changed to 800, white balance set to auto, exposure set to maximum, and the contrast is set to minimum. 8. The picture was then sent to the Image J software for processing. 9. This process was repeated for all 6 patient samples, a positive and negative control, Calf Thymus DNA, and pure water. Image J Software Procedure The process at which an image is turned into an Image J involves several steps. The first step is to set the settings of a camera's phone and then take a picture. The picture should then be emailed or downloaded onto a computer, and it then should be saved to the computer and opened in the Image J software. There are several parameters needed to be adjusted to produce the wanted picture so the measurement needs to be set to integrate the density and the linear gray value. The bubble's green spot is subsequently isolated, integrated density is measured and the background is then deleted to have the isolated desired picture. Research and Development Specific Cancer Marker Detection - The Underlying Technology PCR, or Polymerase Chain Reaction, is a process used to make copies of the same DNA sequences. This process includes a template DNA strand, which serves as the DNA that will be replicated. Primers are also needed to artificially synthesize the DNA strand. Taq polymerase then matches base-pairs, thus replicating the DNA. Magnesium Chloride is also needed because it binds to Taq, allowing it to function. Finally, dNTP’s are the nucleotides, A, T, C, and G, that are used to make the new DNA. The process includes the following: 1. Heat to 95 degrees C. This separates the complementary DNA strands 2. Cool to 57 degrees C. This allows the primers to bind to the DNA strand. 3. Heat to 72 degrees C. This allows Taq to extend the DNA copy 4. Repeat A cancer gene will produce a positive result because only when the cancer gene is present will the primer bind to the template DNA. Therefore, the DNA will be replicated exponentially, creating thousands of the same DNA sequence. If there is no cancer gene present, then the primer cannot bind to the template DNA, and the DNA will not be replicated exponentially. A SNP, or single nucleotide polymorphism, is a point mutation, meaning one nucleotide in a sequence is changed. This change is stable over many generations, and is present in at least 1% of the population. This makes the SNP ideal for a gene marker. The following sequence, rs17879961, was used as a primer for the cancerous gene Cancer Sequence: AAACTCTTACACTGCATACA Normal Sequence: AAACTCTTACATTGCATACA the red C, specifically, makes the gene cancerous The forward primer would be TTT because it matches AAA The backward primer would be TGT because it matches ACA Bayes' rule compares the odds of one event to another. We use it to predict the reliability of the PCR with detecting cancerous genes. In a study of 180 people, 1.1% were shown to have the mutation for cancer. Using Baye's rule, it was found that 7.8% of people should have cancer. The formula for Baye's Rule is p (A|B) = [p(B|A) p(A)]/ p(B) [[[Image:http://www.ornl.gov/sci/techresources/Human_Genome/publicat/primer/91m-1737.gif]]] source: http://www.ornl.gov/sci/techresources/Human_Genome/publicat/primer/pcr.html Results Sample Integrated Density DNA μg/mL Conclusion PCR: Negative Control 594480 0.303589886 Negative PCR: Positive Control 4626020 2.362422427 Positive PCR: Patient 1 ID 58515, rep 1 (Sample A) 816444 0.416942775 Negative PCR: Patient 1 ID 58515, rep 2 (Sample B) 1268071 0.647580289 Negative PCR: Patient 1 ID 58515, rep 3 (Sample C) 1126610 0.575338786 Negative PCR: Patient 2 ID 19033, rep 1 (Sample D) 701057 0.358016779 Negative PCR: Patient 2 ID 19033, rep 2 (Sample E) 275743 0.140816825 Negative PCR: Patient 2 ID 19033, rep 3 (Sample F) 1030791 0.526405804 Negative KEY Sample = The DNA that we tested. Integrated Density = Integrated density means the sum of all the pixels in the selected area. To get this value we used background subtraction. Background subtraction is when the background area value is subtracted from the sample (DNA) area value. DNA μg/mL = To calculate this we used The DNA Calf Thymus Integrated Density and DNA ug/ml, and the integrated Density of another sample. We set it up as a fraction and solved for x. (DNA Calf Thymus Integrated density)/(DNA Calf Thymus DNA ug/ml) = (Integrated density of a sample)/x. Conclusion= If the result was positive it meant that DNA was present and the PCR reaction was successful. If the result was negative it meant that DNA was not present and the PCR reaction was not successful. This is what the positive and negative controls were designed to do. The positive control was meant to be successful and the negative control was not.