BME103:T930 Group 7

BME 103 Fall 2012	Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help
OUR TEAM Name: Wesley Karlin Role(s) Experimental Protocol Planner Name: Lauren Edwards Role(s) Experimental Protocol Planner Name: Raphael Pascua Role(s) Machine Engineers Name: Elyse Candell Role(s) Machine Engineers Name: Katey Hemphill Role(s) Research and Design Scientist LAB 1 WRITE-UP Initial Machine Testing The Original Design Description The OpenPCR Machine creates many copies of a small strand of DNA. In order to duplicate these DNA strands the PCR Machine must use many different temperatures during annealing, denaturing and extension. Experimenting With the Connections When we unplugged the LCD screen from the OpenPCR circuit board, the machine's LED light no longer worked. When we unplugged the white wire that connects the OpenPCR circuit board to the main heating block, the temperature reading on the LCD screen changed. Test Run The date the machine was used was on Thursday October 24th, 2012 10:32:32. The team's experience with the device was as follows: Pro's: Lightweight Silent User Friendly Great Software Con's: Took too long to complete its task Needed a computer Hard open the lid Not Aesthetically Pleasing Flammable (Wood + Extreme Heat=A Bad Situation Waiting to Happen.) Protocols Polymerase Chain Reaction PCR, or Polymerase Chain Reaction, is a process used to make copies of the same DNA sequences. This process includes a template DNA strand, which serves as the DNA that will be replicated. Primers are also needed to artificially synthesize the DNA strand. Taq polymerase then matches base-pairs, thus replicating the DNA. Magnesium Chloride is also needed because it binds to Taq, allowing it to function. Finally, dNTP’s are the nucleotides, A, T, C, and G, that are used to make the new DNA. The process includes the following steps: 1. Heat Denaturation: The heating of DNA to 95 degrees celsius allowed for the separation of the two strands of DNA. The nucleotides lose their base pair partners as the DNA is separated into a positive and a negative strand. 2. Annealing: The DNA now undergoes cooling of 57 degrees celsius to assist the process of annealing. Two primers are necessary for DNA replication as it's the primers that identify the specific targeted strand of DNA. Binding to the complementary sequence, the primers begin to produce the replication that's desired. 3. Extension: To finish off the first cycle of PCR, the temperature is once again raised to 72 degrees celsius. The enzyme Taq DNA polymerase then creates the new DNA strands by making each single strand now a double strand using the complementary sequences produced in annealing. The conclusion of these three steps is the production of two new DNA strands that are the replicate of the original strand. PRC Master Mix Components: - Bacterially derived Taq DNA polymerase - dNTPs - Magnesium Chloride - Reaction buffers Reagent Volume Template DNA (20ng) 0.2 uL 10 uM forward primer 1.0 uL 10 uM reverse primer 1.0 uL GoTaq master mix 50.0 uL dH2O 47.8 uL Total Volume 100 uL (Add your work from Week 3, Part 1 here) Flourimeter Measurements (Add your work from Week 3, Part 2 here) Research and Development Specific Cancer Marker Detection - The Underlying Technology (Add a write-up of the information discussed in Week 3's class) PCR, or Polymerase Chain Reaction, is a process used to make copies of the same DNA sequences. This process includes a template DNA strand, which serves as the DNA that will be replicated. Primers are also needed to artificially synthesize the DNA strand. Taq polymerase then matches base-pairs, thus replicating the DNA. Magnesium Chloride is also needed because it binds to Taq, allowing it to function. Finally, dNTP’s are the nucleotides, A, t C, and G, that are used to make the new DNA. The process includes the following: 1. Heat to 95 degrees C. This separates the complementary DNA strands 2. Cool to 57 degrees C. This allows the primers to bind to the DNA strand. 3. Heat to 72 degrees C. This allows Taq to extend the DNA copy 4. Repeat A cancer gene will produce a positive result because only when the cancer gene is present will the primer bind to the template DNA. Therefore, the DNA will be replicated exponentially, creating thousands of the same DNA sequence. If there is no cancer gene present, then the primer cannot bind to the template DNA, and the DNA will not be replicated exponentially. The following sequence was used as a primer for the cancerous gene AAACTCTTACACTGCATACA the bolded C, specifically, makes the gene cancerous Bayes' rule campares the odds of one event to another. We use it to predict the reliability of the PCR. (BONUS points: Use a program like Powerpoint, Word, Illustrator, Microsoft Paint, etc. to illustrate how primers bind to the cancer DNA template, and how Taq polymerases amplify the DNA. Screen-captures from the OpenPCR tutorial might be useful. Be sure to credit the source if you borrow images.) Results (Your group will add the results of your Fluorimeter measurements from Week 4 here)