BME103:T930 Group 7 l2

BME 103 Fall 2012	Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help
OUR TEAM Name: Student: Elyse Candell Role(s: Machine Engineer) Name: Student Role(s) Name: Student Role(s) Name: Student Role(s) Name: Student Role(s) LAB 2 WRITE-UP Thermal Cycler Engineering Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski. System Design <systemchange.png> Key Features Instructions Protocols Materials Supplied in the Kit Amount Test Tubes 32 Micropipette (10uL-100uL) 1 Disposable Pipette tips 100 PCR Reaction Mix 2 mL Supplied by User Amount Smartphone or Computer 1 Bluetooth Capability in Phone 1 USB Cord with Computer 1 Patient Samples 50 uL per Test Tube PCR Protocol DNA Measurement Protocol Research and Development Background on Disease Markers rs74315509 This SNP is linked to schizophrenia. http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=74315509 Primer Design forward primer: AGGGGGGCCAGGGCCTCAGTG reverse primer: TGCCTTCCGC A CGAGCCCGTC The disease allele will give a PCR product because it will attach to the primer in the PCR, thus replicating exponentially. A non-diesease allele will not attach to the primer, so the DNA can not replicate exponentially. Illustration