BME103:W930 Group1: Difference between revisions
Kevin M. Chu (talk | contribs) |
|||
Line 130: | Line 130: | ||
'''Flourimeter Measurements'''<br> | '''Flourimeter Measurements'''<br> | ||
[[Image:Fluorimeter Group1.jpg|thumb|left| | [[Image:Fluorimeter Group1.jpg|thumb|left|650x325px|]]<br> | ||
Flourimeter Assembly and Experiment Procedures<br> | |||
1. The box was assembled by removing the lid and unbuttoning one of its sides.<br> | |||
2. Then, the box was placed upside down onto the lid, and the unbuttoned flap was lifted up. This created a dark environment that would allow for accurate measurements of the fluorescence of SYBR green dye.<br> | |||
3. Sample A was pipetted onto the slide. Because the slide is superhydrophobic, a drop formed.<br> | |||
4. Then, the slide was placed on the fluorimeter and adjusted so that the light fluoresced through the sample.<br> | |||
5. The superhydrophobic slide and its stand were placed near the back of the dark interior of the box.<br> | |||
6. The cell phone stand was placed near the front of the box, and the smartphone was placed on the stand. <br> | |||
7. Both the cell phone and the hydrophobic slide were aligned in the middle of the box. Neither the phone nor the fluorimeter was moved after adjusting them.<br> | |||
8. Then, using the camera function on the smartphone, the photograph was taken of the sample. <br> | |||
9. Steps 3-8 were repeated with the remaining DNA samples.<br><br> | |||
ImageJ Procedure<br> | |||
1. When each photograph was taken, it was automatically saved into the memory of the smartphone.<br> | |||
2. After all of the photographs had been taken, all of the images were attached to an email and sent to a computer that operated the ImageJ program.<br> | |||
3. The email was received by the computer, and the file containing the image was downloaded by right-clicking on the file and opening with ImageJ.<br> | |||
Revision as of 23:48, 13 November 2012
BME 103 Fall 2012 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 1 WRITE-UPInitial Machine TestingThe Original Design Experimenting With the Connections When we unplugged the LCD screen from the circuit board, the machine's screen stopped displaying. When we unplugged the white wire that connects the circuit board to the heated lid, the machine stopped controlling the temperature.
Our group had machine #1. During our first test run on October 24, 2012, the machine's fan would not work and therefore we could not complete the DNA replication.
ProtocolsPolymerase Chain Reaction How PCR Works Thermal Cycling Components of the PCR master mix • 2X Colorless Go Taq ® Reaction Buffer (pH 8.5)
Positive Control Negative Control Patient 1 Patient 1 Patient 1 Patient 2 Patient 2 Patient 2
Flourimeter Assembly and Experiment Procedures ImageJ Procedure
Research and DevelopmentSpecific Cancer Marker Detection - The Underlying Technology The primer sequence of the single nucleotide polymorphism (SNP) that is linked to colorectal cancer is GGAAGTGGGTCCTAAAAACTCTTACA[C/T]TGCATACATAGAAGATCAGAGTGGC. The gene being affected is CHK2 (checkpoint kinase 2). The allele change is from T to C, which signifies the cancer sequence. The cancer sequence-binding primer, or the reverse primer, is AACTCTACA[C]TGCATACAT. The coordinate of the cancer base pair "C" is at 29,121,087 of the DNA sequence. 20 base pairs (bp) to the left of the cancer sequence was TA, which occurred at coordinate 29,121,067. Baye's reasoning and statistical formulas can be applied to find the link between the development of cancer and the presence of the cancer gene. In a sample size of 180 patients, 1.1% of contained a single copy of the colorectal cancer (CRC) gene in their DNA (C/T) and 98.9% had no copy of the cancer gene (T/T). According to Baye's rule, the probability of having cancer and also expressing the "C" cancer gene is 1.1% when the probability of expressing the "C" gene and also having cancer is 7.8%, the probability of having cancer is unknown, and standard probability of having cancer over the population is 5.3%. Therefore, the probability of having cancer with the "C" gene is 0.74%. (BONUS points: Use a program like Powerpoint, Word, Illustrator, Microsoft Paint, etc. to illustrate how primers bind to the cancer DNA template, and how Taq polymerases amplify the DNA. Screen-captures from the OpenPCR tutorial might be useful. Be sure to credit the source if you borrow images.)
Results
|