BME103:W930 Group1: Difference between revisions
Line 157: | Line 157: | ||
The primer sequence of the single nucleotide polymorphism (SNP) that is linked to colorectal cancer is GGAAGTGGGTCCTAAAAACTCTTACA [C/T] TGCATACATAGAAGATCAGAGTGGC. The allele change is from T to C, meaning that when the T base pair mutates into a C base pair, the cancer sequence is expressed. The gene being affected in this mutation is checkpoint kinase 2 (CHK2). Detection of this gene mutation is achieved through a process called polymerase chain reaction (PCR), which is a technology that amplifies a single copy of DNA to generate a multitude of that specific sequence. This allows scientists and researches to isolate a specific DNA sequence in order to compare it to a specific phenotype, which in this case is the presence of colorectal cancer. The cancer sequence-binding primer, or the reverse primer, is AACTCTACA[C]TGCATACAT. The coordinate (location) of the cancer base pair "C" is at 29,121,087 of the DNA sequence. 20 base pairs to the left of the cancer sequence was TA, which occurred at coordinate 29,121,067.<br> | The primer sequence of the single nucleotide polymorphism (SNP) that is linked to colorectal cancer is GGAAGTGGGTCCTAAAAACTCTTACA [C/T] TGCATACATAGAAGATCAGAGTGGC. The allele change is from T to C, meaning that when the T base pair mutates into a C base pair, the cancer sequence is expressed. The gene being affected in this mutation is checkpoint kinase 2 (CHK2). Detection of this gene mutation is achieved through a process called polymerase chain reaction (PCR), which is a technology that amplifies a single copy of DNA to generate a multitude of that specific sequence. This allows scientists and researches to isolate a specific DNA sequence in order to compare it to a specific phenotype, which in this case is the presence of colorectal cancer. The cancer sequence-binding primer, or the reverse primer, is AACTCTACA[C]TGCATACAT. The coordinate (location) of the cancer base pair "C" is at 29,121,087 of the DNA sequence. 20 base pairs to the left of the cancer sequence was TA, which occurred at coordinate 29,121,067.<br> | ||
Baye's reasoning and statistical formulas can be applied to find the link between the development of cancer and the presence of the cancer gene in the SNP. In a sample size of 180 patients, 1.1% of contained a single copy of the colorectal cancer (CRC) gene in their DNA (C/T) and 98.9% had no copy of the cancer gene (T/T). According to Baye's rule, when the probability of expressing the "C" gene and also having cancer is 7.8: <br> | Baye's reasoning and statistical formulas can be applied to find the link between the development of cancer and the presence of the cancer gene in the SNP. In a sample size of 180 patients, 1.1% of contained a single copy of the colorectal cancer (CRC) gene in their DNA (C/T) and 98.9% had no copy of the cancer gene (T/T). According to Baye's rule, when the probability of expressing the "C" gene and also having cancer is 7.8%: <br> | ||
The probability of having cancer and also expressing the "C" gene = 1.1% <br> | The probability of having cancer and also expressing the "C" gene = 1.1% <br> |
Revision as of 13:44, 14 November 2012
BME 103 Fall 2012 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
OUR TEAM
All members of the group participated within their respective roles and contributed to the content of this page. Bri Ackerman, Haley Parrott, and Michael Dennison did not have their accounts verified by the time this page was submitted, therefore their names will not show up in the editing history.
LAB 1 WRITE-UPInitial Machine TestingThe Original Design Experimenting With the Connections Test Run
ProtocolsPolymerase Chain Reaction Thermal Cycling Components of the PCR master mix Reagent and Volume of DNA Solution
Description of DNA Samples Patient 1 Patient 1 Patient 1 Patient 2 Patient 2 Patient 2
Flourimeter Assembly and Experiment Procedure ImageJ Procedure
Research and DevelopmentSpecific Cancer Marker Detection - The Underlying Technology The primer sequence of the single nucleotide polymorphism (SNP) that is linked to colorectal cancer is GGAAGTGGGTCCTAAAAACTCTTACA [C/T] TGCATACATAGAAGATCAGAGTGGC. The allele change is from T to C, meaning that when the T base pair mutates into a C base pair, the cancer sequence is expressed. The gene being affected in this mutation is checkpoint kinase 2 (CHK2). Detection of this gene mutation is achieved through a process called polymerase chain reaction (PCR), which is a technology that amplifies a single copy of DNA to generate a multitude of that specific sequence. This allows scientists and researches to isolate a specific DNA sequence in order to compare it to a specific phenotype, which in this case is the presence of colorectal cancer. The cancer sequence-binding primer, or the reverse primer, is AACTCTACA[C]TGCATACAT. The coordinate (location) of the cancer base pair "C" is at 29,121,087 of the DNA sequence. 20 base pairs to the left of the cancer sequence was TA, which occurred at coordinate 29,121,067. Baye's reasoning and statistical formulas can be applied to find the link between the development of cancer and the presence of the cancer gene in the SNP. In a sample size of 180 patients, 1.1% of contained a single copy of the colorectal cancer (CRC) gene in their DNA (C/T) and 98.9% had no copy of the cancer gene (T/T). According to Baye's rule, when the probability of expressing the "C" gene and also having cancer is 7.8%: The probability of having cancer and also expressing the "C" gene = 1.1%
Results
|