BME103:W930 Group1: Difference between revisions
Kevin M. Chu (talk | contribs) |
|||
(9 intermediate revisions by the same user not shown) | |||
Line 35: | Line 35: | ||
[[Image:Open_PCR_with_labels.png|thumb|right|700x350px|]]<br> | [[Image:Open_PCR_with_labels.png|thumb|right|700x350px|]]<br> | ||
'''The Original Design'''<br> | '''The Original Design'''<br> | ||
This picture (click to enlarge) illustrates the original design of the Open PCR machine showing inner mechanisms. As the image shows, | This picture (click to enlarge) illustrates the original design of the Open PCR machine showing inner mechanisms. As the image shows, the Open PCR machine primarily consists of 5 parts: the LCD screen, heated lid, heater, circuit board, and fan. While the machine is portable and easy to use, the design is fragile and has a high failure rate, along with several other design flaws. | ||
'''Experimenting With the Connections'''<br> | '''Experimenting With the Connections'''<br> | ||
Line 41: | Line 41: | ||
'''Test Run'''<br> | '''Test Run'''<br> | ||
Our group used machine #1. During our first test run on October 24, 2012, the PCR machine was connected to a laptop that contained the program for the thermal cycling process. All of the tubes containing the DNA samples were placed into the tray, which was then placed into the | Our group used machine #1. During our first test run on October 24, 2012, the PCR machine was connected to a laptop that contained the program for the thermal cycling process. All of the tubes containing the DNA samples were placed into the tray, which was then placed into the open PCR machine. During the amplification, the machine's fan was not functioning. Therefore, we could not complete the DNA replication. However, previously prepared DNA solutions were available, so we conducted the experiment with these samples instead.<br> | ||
Line 56: | Line 56: | ||
2. During denaturing, the temperature was held at a constant 95°C for an additional 30 seconds to break the hydrogen bonds between the complementary bases in the DNA molecules.<br> | 2. During denaturing, the temperature was held at a constant 95°C for an additional 30 seconds to break the hydrogen bonds between the complementary bases in the DNA molecules.<br> | ||
3. During annealing, the temperature was decreased to 55°C for 30 seconds to allow the specific primers to attach to the region of DNA encoding the cancer gene.<br> | 3. During annealing, the temperature was decreased to 55°C for 30 seconds to allow the specific primers to attach to the region of DNA encoding the cancer gene.<br> | ||
4. During extension, the temperature was increased to 72°C for one minute to allow Taq DNA polymerase to bind deoxynucleoside triphosphates (dNTPs) on the template DNA | 4. During extension, the temperature was increased to 72°C for one minute to allow Taq DNA polymerase to bind deoxynucleoside triphosphates (dNTPs) on the template DNA. Lengthening the synthetic strand.<br> | ||
5. The temperature was decreased to 20°C during the final hold.<br> | 5. The temperature was decreased to 20°C during the final hold.<br> | ||
6. To obtain a sufficient number of DNA samples, the entire process was repeated 30 times.<br> | 6. To obtain a sufficient number of DNA samples, the entire process was repeated 30 times.<br> | ||
Line 198: | Line 198: | ||
KEY | KEY | ||
* '''Sample''' = Each sample is a solution of amplified DNA obtained via PCR. The first four rows of the table display the water sample, calf thymus DNA, negative control | * '''Sample''' = Each sample is a solution of amplified DNA obtained via PCR. The first four rows of the table display the water sample, calf thymus DNA, negative control and positive control. Rows 5-7 show results for 3 replicates of patient 1, and rows 8-10 show 3 replicates of patient 2. | ||
* '''Integrated Density''' = Integrated Density (INTDEN) is a measurement of the mean gray value for a specific area. The INTDEN values in the table were calculated by determining the INTDEN of the drop and subtracting it from the INTDEN of the background. | * '''Integrated Density''' = Integrated Density (INTDEN) is a measurement of the mean gray value for a specific area. The INTDEN values in the table were calculated by determining the INTDEN of the drop and subtracting it from the INTDEN of the background. | ||
* '''DNA μg/mL''' = The concentration of DNA in each sample was calculated by multiplying each sample's INTDEN value by 2 and dividing by the INTDEN value of the calf thymus. | * '''DNA μg/mL''' = The concentration of DNA in each sample was calculated by multiplying each sample's INTDEN value by 2 and dividing by the INTDEN value of the calf thymus. |
Latest revision as of 13:45, 14 November 2012
BME 103 Fall 2012 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
OUR TEAM
All members of the group participated within their respective roles and contributed to the content of this page. Bri Ackerman, Haley Parrott, and Michael Dennison did not have their accounts verified by the time this page was submitted, therefore their names will not show up in the editing history.
LAB 1 WRITE-UPInitial Machine TestingThe Original Design Experimenting With the Connections Test Run
ProtocolsPolymerase Chain Reaction Thermal Cycling Components of the PCR master mix Reagent and Volume of DNA Solution
Description of DNA Samples Patient 1 Patient 1 Patient 1 Patient 2 Patient 2 Patient 2
Flourimeter Assembly and Experiment Procedure ImageJ Procedure
Research and DevelopmentSpecific Cancer Marker Detection - The Underlying Technology The primer sequence of the single nucleotide polymorphism (SNP) that is linked to colorectal cancer is GGAAGTGGGTCCTAAAAACTCTTACA [C/T] TGCATACATAGAAGATCAGAGTGGC. The allele change is from T to C, meaning that when the T base pair mutates into a C base pair, the cancer sequence is expressed. The gene being affected in this mutation is checkpoint kinase 2 (CHK2). Detection of this gene mutation is achieved through a process called polymerase chain reaction (PCR), which is a technology that amplifies a single copy of DNA to generate a multitude of that specific sequence. This allows scientists and researches to isolate a specific DNA sequence in order to compare it to a specific phenotype, which in this case is the presence of colorectal cancer. The cancer sequence-binding primer, or the reverse primer, is AACTCTACA[C]TGCATACAT. The coordinate (location) of the cancer base pair "C" is at 29,121,087 of the DNA sequence. 20 base pairs to the left of the cancer sequence was TA, which occurred at coordinate 29,121,067. Baye's reasoning and statistical formulas can be applied to find the link between the development of cancer and the presence of the cancer gene in the SNP. In a sample size of 180 patients, 1.1% of contained a single copy of the colorectal cancer (CRC) gene in their DNA (C/T) and 98.9% had no copy of the cancer gene (T/T). According to Baye's rule, when the probability of expressing the "C" gene and also having cancer is 7.8%: The probability of having cancer and also expressing the "C" gene = 1.1%
Results
|