BME103:W930 Group1

BME 103 Fall 2012	Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help
OUR TEAM Name: Kevin Chu Experimental Protocol Planner Name: Michael Dennison Experimental Protocol Planner Name: Zhiyue Yang Machine Engineer Name: Vanessa Barker Machine Engineer Name: Student Role(s) LAB 1 WRITE-UP Initial Machine Testing The Original Design ) Original design of the Open PCR machine showing inner mechanisms. As the image shows, this Open PCR machine primarily consists of 5 parts: the LCD screen, heated lid, heater, circuit board, and fan. While the machine is portable and easy to use, the design is fragile and has a high failure rate, along with several other design flaws. Experimenting With the Connections When we unplugged the LCD screen from the circuit board, the machine's screen stopped displaying. When we unplugged the white wire that connects the circuit board to the heated lid, the machine stopped controlling the temperature. Test Run Our group had machine #1. During our first test run on October 24, 2012, the machine's fan would not work and therefore we could not complete the DNA replication. Protocols Polymerase Chain Reaction How PCR Works Polymerase chain reaction (PCR) is a process that amplifies minute quantities of DNA in order to obtain a sufficient number of samples for analysis. DNA is a useful health marker and can predict the likelihood that a patient has cancer. During PCR, the double helix structure is unzipped to expose the bases. DNA primer is added to the DNA solution and binds to the gene that causes cancer. Because a non-cancer gene has a different nucleotide sequence from the cancer gene, the primer will not be able to attach to the exposed bases, so the DNA cannot be amplified. DNA amplification involves a sequence of steps called thermal cycling. Thermal Cycling 1. To separate complementary base pairs, the sample was heated at 95°C for two minutes. 2. During annealing, the temperature was decreased to 57°C to allow the specific primers to attach. This step usually lasts between 30 seconds and one minute. 3. During extension, the temperature is increased to 72°C for one minute to allow Taq DNA polymerase to bind deoxynucleoside triphosphates (dNTPs) on the template DNA, lengthening the synthetic strand. 4. To obtain a sufficient number of samples, the process was repeated 30 times. Components of the PCR master mix • 2X Colorless Go Taq ® Reaction Buffer (pH 8.5) • 400μM dATP • 400μM dGTP • 400μM dCTP • 400μM dTTP • 3mM MgCl2 Reagent Volume Template DNA (20 ng) 0.1μL 10μM forward primer 0.5μL 10μM reverse primer 0.5μL GoTaq master mix 25.0μL dH2O 23.9μL Total Volume 50.0μL Positive Control Cancer DNA template Negative Control DNA Template Patient 1 Replicate 1 ID: 92336 Gender: Male Age: 58 Patient 1 Replicate 2 ID: 92336 Gender: Male Age: 58 Patient 1 Replicate 3 ID: 92336 Gender: Male Age: 58 Patient 2 Replicate 1 ID: 44606 Gender: Male Age: 47 Patient 2 Replicate 2 ID: 44606 Gender: Male Age: 47 Patient 2 Replicate 3 ID: 44606 Gender: Male Age: 47 Flourimeter Measurements Research and Development Specific Cancer Marker Detection - The Underlying Technology The primer sequence of the single nucleotide polymorphism (SNP) that is linked to colorectal cancer is GGAAGTGGGTCCTAAAAACTCTTACA[C/T]TGCATACATAGAAGATCAGAGTGGC. The gene being affected is CHK2 (checkpoint kinase 2). The allele change is from T to C, which signifies the cancer sequence. The cancer sequence-binding primer, or the reverse primer, is AACTCTACA[C]TGCATACAT. The coordinate of the cancer base pair "C" is at 29,121,087 of the DNA sequence. 20 base pairs (bp) to the left of the cancer sequence was TA, which occurred at coordinate 29,121,067. Baye's reasoning and statistical formulas can be applied to find the link between the development of cancer and the presence of the cancer gene. In a sample size of 180 patients, 1.1% of contained a single copy of the colorectal cancer (CRC) gene in their DNA (C/T) and 98.9% had no copy of the cancer gene (T/T). According to Baye's rule, the probability of having cancer and also expressing the "C" cancer gene is 1.1% when the probability of expressing the "C" gene and also having cancer is 7.8%, the probability of having cancer is unknown, and standard probability of having cancer over the population is 5.3%. Therefore, the probability of having cancer with the "C" gene is 0.74%. (BONUS points: Use a program like Powerpoint, Word, Illustrator, Microsoft Paint, etc. to illustrate how primers bind to the cancer DNA template, and how Taq polymerases amplify the DNA. Screen-captures from the OpenPCR tutorial might be useful. Be sure to credit the source if you borrow images.) Results Sample Integrated Density DNA μg/mL Conclusion PCR: Water 9647140 0.0000 No Signal PCR: Calf thymus DNA 54999590 2.0000 Positive PCR: Negative Control 6549794 0.2382 No Signal PCR: Positive Control 48651893 1.7692 Positive PCR: Patient 1 ID 92336, rep 1 42249825 1.5364 Positive PCR: Patient 1 ID 92336, rep 2 38240163 1.3906 Positive PCR: Patient 1 ID 92336, rep 3 65596983 2.3854 Positive PCR: Patient 2 ID 44606, rep 1 10866235 0.3951 No Signal PCR: Patient 2 ID 44606, rep 2 16970600 0.6171 No Signal PCR: Patient 2 ID 44606, rep 3 12971264 0.4717 No Signal KEY Sample = Each sample is a solution of amplified DNA obtained via PCR. The first four rows of the table display the water sample, calf thymus DNA, negative control, and positive control. Rows 5-7 show results for 3 replicates of patient 1, and rows 8-10 show 3 replicates of patient 2. Integrated Density = Integrated Density (INTDEN) is a measurement of the mean gray value for a specific area. The INTDEN values in the table were calculated by determining the INTDEN of the drop and subtracting it from the INTDEN of the background. DNA μg/mL = The concentration of DNA in each sample was calculated by multiplying each sample's INTDEN value by 2 and dividing by the INTDEN value of the calf thymus. Conclusion = Each calculated DNA concentration was compared to the concentrations of both the negative and positive controls. The samples with concentrations closer to the negative result produced no signal while the samples with concentrations closer to the positive result produced a positive test for cancer.