BME103:W930 Group10

From OpenWetWare

Revision as of 18:49, 14 November 2012 by Colin Dow Siguenza (Talk | contribs)
(diff) ←Older revision | Current revision (diff) | Newer revision→ (diff)
Jump to: navigation, search
BME 103 Fall 2012 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help
Image:BME494_Asu_logo.png

Contents

OUR TEAM

Name: Susan SajadiRole(s): Open PCR Machine Engineer
Name: Susan Sajadi
Role(s): Open PCR Machine Engineer
Name: Raymond FelicianoRole(s): Open PCR Machine Engineer
Name: Raymond Feliciano
Role(s): Open PCR Machine Engineer
Name: Britny SepulvedaRole(s): Experimental Protocol Planner
Name: Britny Sepulveda
Role(s): Experimental Protocol Planner
Name: Rachel LundeenRole(s): R&D Scientist
Name: Rachel Lundeen
Role(s): R&D Scientist
Name: Elizabeth LopezRole(s): Experimental Protocol Planner
Name: Elizabeth Lopez
Role(s): Experimental Protocol Planner
Name: Larry MossRole(s): R&D Scientist
Name: Larry Moss
Role(s): R&D Scientist
Name: Collin Siguenza Role(s): R&D Scientist
Name: Collin Siguenza
Role(s): R&D Scientist
Name: Rotem BergerRole(s): Experimental Protocol Planner
Name: Rotem Berger
Role(s): Experimental Protocol Planner

LAB 1 WRITE-UP

Initial Machine Testing

The Original Design
Image:pcrmachine.jpg

This is the OpenPCR machine utilized to automate polymerase chain reactions. This reaction allows for the amplification of specific DNA which is useful for detecting different markers, such as those indiciating an increased risk for cancer, presence of HIV, etc.

Experimenting With the Connections

When we unplugged the LCD screen from the Open PCR circuit board, the machine's LCD screen did not turn on.

When we unplugged the white wire that connects Open PCR circuit board to the heat sink, there appeared to be no effect, however, it is likely that the heat sink would not function during a trial.


Test Run

On Oct. 24th, 2012, we first used the Open PCR machine number 10 to run 25 cycles on eight samples which included two sets of three samples and a positive and negative control. The process was successful, taking about 90 minutes for the reaction to complete. Initial testing of the device indicated that the machine and software were synced in regards to the temperature during each cycle.




Protocols

Polymerase Chain Reaction

Polymerase Chain Reaction(PCR) works by using a mix of enzymes that transcribe sections of DNA. The enzyme mix is combined with patient DNA. Then, the sample is heated and cooled in regular cycles to match the ideal temperatures for the different enzymes. This will result in replication of the specific section of DNA that is being tested.

Steps to amplify a patient's DNA sample:
1. Add 50 microliters PCR master mix of enzymes to patient DNA sample
2. Put in PCR machine 
3. Run for 25 cycles at 95 degrees C for 30 seconds, 57 degrees C for 30 seconds, and 72 degrees C for 30 seconds  
Reagent Volume
Template DNA (20 ng)0.2 μL
10 μM forward primer1.0 μL
10 μM reverse primer1.0 μL
GoTaq master mix50.0 μL
dH2O47.8 μL
Total Volume100.0 μL


Positive Control:
cancer DNA template
Negative Control:
no DNA template
Patient 1:
ID 29013
Replicate 1
Tube Label: O1
Patient 1:
ID 29013
Replicate 2
Tube Label: O2
Patient 1:
ID 29013
Replicate 3
Tube Label: O3 Patient 2:
ID 13146
Replicate 1
Tube Label: delta 1
Patient 2:
ID 13146
Replicate 2
Tube Label: delta 2
Patient 2:
ID 13146
Replicate 3
Tube Label: delta 3


Fluorescent Measurements

Flourimeter Setup:
1. Place the glass slide onto the device.
2. Turn on the blue light and move the slide to have the light positioned between two of the dots on the slide.
3. Place two drops of the dye and two drops of the samples spread over two of the dots on the slide. Make sure drops are placed over two dots vertically not horizontally or side by side.
4. Place the phone in the holder close enough to the device to get a close picture.
5. Place the box over the device and phone holder.
6. Close the box as much as possible and take picture.

Camera Setting: The camera had the flash off, ISO at 800, auto white balance, high exposure, high saturation, and low contrast.

ImageJ Procedure:
1. Open up the image.
2. Go to Set Measurement under the tab analyze, and select area, integrated density, and mean grey value. After doing this once, the setting should remain the same.
3. Split the channels, by going under the tab Image, and then Color. This will split the file into three files, one of which will be labeled as a green channel.
4. Select the green image and then select the oval selection tool.
5. Draw an oval around the droplet in the image and select Measure under the Analyze tab.
6. The same oval can me moved to the background of the image. Then select Measure.
7. Record all values, or save them as an excel file in ImageJ.
8. Repeat all steps for each image.




Research and Development

Specific Cancer Marker Detection - The Underlying Technology

The NCBI database allows for genes to be searched through in order to determine different mutations and information about them. In this lab, we looked up CHEK2 as it related to rs17879961, a human gene, in the Short Genetic Variations database. CHEK2 is checkpoint kinase 2 which happens in response to DNA damage. Through the database, it was found that a missense mutation occured in the 22nd chromosome. The primer of the cancer sequence is

GGAAGTGGGTCCTAAAAACTCTTACA[C/T]TGCATACATAGAAGATCACAGTGGC

and the reverse primer to this would be

AACTCTTACACTGCATACAT.

The mutation for cancer changes the codon "ATT" to "ACT" in the DNA sequence. This change codes for cancers such as breast and colorectal cancer. The reason why cancer mutations give a positive PCR signal, while a non-cancer sequence gives no signal, is a result of the primer that attaches to the sequence. The primer is coded for the specific codon "ACT" and will only attach if the sequence is such, which then allows the Taq Polymerase to bind and replicate the DNA exponentially. If the primer sees that the codon is "ATT," it will not bind and therefore will not replicate and cause the PCR signal to be positive. In this lab, the samples that exhibited the fluorescent dye were the ones in which the PCR signal was positive and therefore had cancer. Baye's Rule is used to determine the probability that a person has cancer or not. In a study of 180 people, 1.1% have the mutation for cancer while 98.9% do not. Using Baye's rule, it was found that 7.8% should have cancer. The formula for Baye's Rule is p (hc|C) = p(C|hc) p(hc) / p(C)

BBNs0050.gif


Image:group10pcr.jpg[2]
Image:taqpolymer.jpg[1]

For an animated walkthrough of the process, check out this PCR Virtual Lab from the team at the University of Utah's Genetic Science Learning Center

Results

Data Measured via ImageJ

Sample ID Area & x,y,w,h info
Mean Pixel Value
INTDEN
RAWINTDEN INTDEN
110927 Sample 28072 65.2 18311650 18311650
110927 Background 28072 4.359 122377 122377
110501 Sample 28768 119.163 3428070 3428070
110501 Background 28768 2.39 68746 68746
1110252 Sample 27024 123.912 3348606 3348606
1110252 Background 27024 4.782 129231 129231
110052 Sample 23072 107.179 2472834 2472834
110052 Background 23072 3.558 82088 82088
105842 Sample 25784 66.01 1701990 1701990
105842 Background 25784 5.104 131592 131592
11121 Sample 5120 86.627 443529 443529
11121 Background 5120 4.591 23505 23505
111314 Sample 6908 52.91 365499 365499
111314 Background 6908 3.319 21685 21685
1115585 Sample 5812 112.53 654023 654023
111558 Background 5812 5.567 32358 32358


Sample ID INTDEN with background subtracted
11092718189273
110501 3359324
1110252 3219375
110052 2390746
105842 1570398
11121 420024
111314 343814
1115585 621665

Green Channel With DNA

Image:GreenchannelwithDNAgroup10.jpg

Green Channel With Water

Image:Greenchannelwithwatergroup10.jpg



Data Measured via ImageJ

Sample ID Drop 1
Drop 2
110927 dye 01
110501 dye delta 3
105538 dye water
1110252 dye delta 2
110052 dye delta 1
105842 dye negative control
11121 dye 02
111314 dye 03
1115585 dye DNA standard
Sample Integrated Density DNA μg/mL Conclusion
PCR: Negative Control E6 F6 G6
PCR: Positive Control E7 F7 G7
PCR: Patient 1 ID #####, rep 1 E8 F8 G8
PCR: Patient 1 ID #####, rep 2 E9 F9 G9
PCR: Patient 1 ID #####, rep 3 E10 F10 G10
PCR: Patient 2 ID #####, rep 1 E11 F11 G11
PCR: Patient 2 ID #####, rep 2 E12 F12 G12
PCR: Patient 2 ID #####, rep 3 E13 F13 G13


KEY

  • Sample = The sample is the given DNA which may or may not contain the codon for cancer.
  • Integrated Density = The integrated density is the sum of the values of pixels in an area. The integrated density in this lab can be found by subtracting the integrated density of the background from the integrated density of the samples.
  • DNA μg/mL =
  • Conclusion = The fluorescence test showed whether or not the samples had the codon for cancer. If the sample glowed, then it had the cancer, but if it did not glow, it did not have the cancer gene.



Works Cited

[1] "Microbial Chatter." - Thermus Aquaticus. N.p., n.d. Web. 31 Oct. 2012. <http://docp.edublogs.org/thermus-aquaticus/>.

[2] "Replication." Shmoop. N.p., n.d. Web. 31 Oct. 2012. <http://www.shmoop.com/dna/dna-replication.html>.

Personal tools