BME103:W930 Group10 l2: Difference between revisions
(6 intermediate revisions by 4 users not shown) | |||
Line 40: | Line 40: | ||
'''Key Features'''<br> | '''Key Features'''<br> | ||
<b>PCR Heating Block</b> The new design will be much larger, to include as many samples as possible to accomodate a standard classroom size. This includes a color coordinated tray. | <hr> | ||
<b>PCR Heating Block</b><br> | |||
The new design will be much larger, to include as many samples as possible to accomodate a standard classroom size. This includes a color coordinated tray. | |||
<b>Benefit and Function</b><br> | <b>Benefit and Function</b><br> | ||
Line 47: | Line 49: | ||
<b>Heat Sink/Fan/etc</b><br> | <b>Heat Sink/Fan/etc</b><br> | ||
These pieces will be enlarged accordingly with the other parts of the device as necessary for the additional samples. The placement may also be shifted for this accommodation with smaller class sizes. | These pieces will be enlarged accordingly with the other parts of the device as necessary for the additional samples. The placement may also be shifted for this accommodation with smaller class sizes. | ||
Benefit and Function | |||
<b>Benefit and Function </b> | |||
Since this device is aimed at being educational, an important factor is price. It will be cheaper to use a larger device to accomodate more students. | |||
'''Instructions'''<br> | '''Instructions'''<br> | ||
Line 168: | Line 172: | ||
Reverse Primer for Type 2 Diabetes: <br> GGGCATGTTTGCAAACACAATCAGTATCTTAATCTACTGTCC <br> | Reverse Primer for Type 2 Diabetes: <br> GGGCATGTTTGCAAACACAATCAGTATCTTAATCTACTGTCC <br> | ||
Forward Primer for Insomnia: <br> ACAGCAACCAGAACAACTTTGTGCAC[A/G]ACTGCGTCAATATCACAATCAAGCA <br> | Forward Primer for Insomnia: <br> ACAGCAACCAGAACAACTTTGTGCAC[A/G]ACTGCGTCAATATCACAATCAAGCA <br> | ||
Reverse Primer for Insomnia: <br> | Reverse Primer for Insomnia: <br> CTGAAAAAGGACACCGGAAAATGCACTGAGAAAGGCGAGTCCTTTGTCTGAGCCATACCC <br> | ||
Latest revision as of 16:31, 28 November 2012
BME 103 Fall 2012 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | ||||||||||||||||||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Tito Jankowski and Josh Perfetto . System Design PCR Heating Block Key Features PCR Heating Block Benefit and Function Heat Sink/Fan/etc Benefit and Function Since this device is aimed at being educational, an important factor is price. It will be cheaper to use a larger device to accomodate more students. Instructions
ProtocolsMaterials
PCR Protocol
Flourimeter Setup: DNA Measurement Protocol ImageJ Procedure: Research and DevelopmentBackground on Disease Markers There are two diseases that our group decided to look into. The first disease is type II diabetes, which is the most common of the diabetes. The body does not produce enough insulin, which regulates the use of glucose, therefore leading to high levels of glucose in the blood. There is a mutation in the third chromosome which causes this disease. The SNP related to this is rs4402960 [1]. The second disease is insomnia. This is a sleeping disorder in which a person cannot fall asleep or stay asleep for as long as they would like. It is caused by a mutation in the twentieth chromosome. The SNP related to this is rs74315403 [2].
|