BME103:W930 Group10 l2: Difference between revisions
(10 intermediate revisions by 5 users not shown) | |||
Line 30: | Line 30: | ||
Our re-design is based upon the [http://openpcr.org Open PCR] system originally designed by Tito Jankowski and Josh Perfetto .<br> | Our re-design is based upon the [http://openpcr.org Open PCR] system originally designed by Tito Jankowski and Josh Perfetto .<br> | ||
<center> | |||
'''System Design'''<br> | '''System Design'''<br> | ||
[[Image:Pcrmachineplasticgroup10.jpg]] | [[Image:Pcrmachineplasticgroup10.jpg]] | ||
PCR Block | PCR Heating Block | ||
[[Image:Tray10.png]] | [[Image:Tray10.png]]</center> | ||
'''Key Features'''<br> | '''Key Features'''<br> | ||
PCR Block | <hr> | ||
<b>PCR Heating Block</b><br> | |||
The new design will be much larger, to include as many samples as possible to accomodate a standard classroom size. This includes a color coordinated tray. | The new design will be much larger, to include as many samples as possible to accomodate a standard classroom size. This includes a color coordinated tray. | ||
Heat Sink/Fan/etc | <b>Benefit and Function</b><br> | ||
The color coordination will make it easier to keep track of the samples. The larger size will allow more students to participate | |||
<b>Heat Sink/Fan/etc</b><br> | |||
These pieces will be enlarged accordingly with the other parts of the device as necessary for the additional samples. The placement may also be shifted for this accommodation with smaller class sizes. | These pieces will be enlarged accordingly with the other parts of the device as necessary for the additional samples. The placement may also be shifted for this accommodation with smaller class sizes. | ||
Benefit and Function | |||
<b>Benefit and Function </b> | |||
Since this device is aimed at being educational, an important factor is price. It will be cheaper to use a larger device to accomodate more students. | |||
'''Instructions'''<br> | '''Instructions'''<br> | ||
In this design the assembly and instructions will remain the same. In fact, color-coordination will make the instructions easier to follow, | In this design the assembly and instructions will remain the same. In fact, color-coordination will make the instructions easier to follow. Also, many of the pieces will be larger and easier to handle than previous designs. The materials will also be different, however they will have the same function. | ||
<!--- From Week 4 exercise ---> | <!--- From Week 4 exercise ---> | ||
Line 104: | Line 109: | ||
| Open PCR||1 | | Open PCR||1 | ||
|- | |- | ||
| Epindorf Tubes|| | | Epindorf Tubes||32 | ||
|- | |- | ||
| Pipettes||10 | | Pipettes||10 | ||
Line 127: | Line 132: | ||
'''PCR Protocol''' | '''PCR Protocol''' | ||
<br> The PCR machine is color coded by row. Each group of students is assigned a color, up to eight groups. The groups will then set up the Open PCR on the computer, plug in the PCR machine and turn it on. Then, the students will put the DNA samples into the tubes via the pipettes, utilizing | <br> The PCR machine is color coded by row. Each group of students is assigned a color, up to eight groups. The groups will then set up the Open PCR on the computer, plug in the PCR machine and turn it on. Then, the students will put the DNA samples into the tubes via the pipettes, utilizing two different samples, a positive control, and a negative control. The students will then place their test tubes into their assigned colored row and the teacher will close the lid and start the program. Students will run this for two hours so that the PCR machine can amplify the DNA samples for 30-35 cycles, depending on the teacher's discretion and time constraints. | ||
Flourimeter Setup: <br> | Flourimeter Setup: <br> | ||
Line 167: | Line 172: | ||
Reverse Primer for Type 2 Diabetes: <br> GGGCATGTTTGCAAACACAATCAGTATCTTAATCTACTGTCC <br> | Reverse Primer for Type 2 Diabetes: <br> GGGCATGTTTGCAAACACAATCAGTATCTTAATCTACTGTCC <br> | ||
Forward Primer for Insomnia: <br> ACAGCAACCAGAACAACTTTGTGCAC[A/G]ACTGCGTCAATATCACAATCAAGCA <br> | Forward Primer for Insomnia: <br> ACAGCAACCAGAACAACTTTGTGCAC[A/G]ACTGCGTCAATATCACAATCAAGCA <br> | ||
Reverse Primer for Insomnia: <br> | Reverse Primer for Insomnia: <br> CTGAAAAAGGACACCGGAAAATGCACTGAGAAAGGCGAGTCCTTTGTCTGAGCCATACCC <br> | ||
Latest revision as of 16:31, 28 November 2012
BME 103 Fall 2012 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | ||||||||||||||||||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Tito Jankowski and Josh Perfetto . System Design PCR Heating Block Key Features PCR Heating Block Benefit and Function Heat Sink/Fan/etc Benefit and Function Since this device is aimed at being educational, an important factor is price. It will be cheaper to use a larger device to accomodate more students. Instructions
ProtocolsMaterials
PCR Protocol
Flourimeter Setup: DNA Measurement Protocol ImageJ Procedure: Research and DevelopmentBackground on Disease Markers There are two diseases that our group decided to look into. The first disease is type II diabetes, which is the most common of the diabetes. The body does not produce enough insulin, which regulates the use of glucose, therefore leading to high levels of glucose in the blood. There is a mutation in the third chromosome which causes this disease. The SNP related to this is rs4402960 [1]. The second disease is insomnia. This is a sleeping disorder in which a person cannot fall asleep or stay asleep for as long as they would like. It is caused by a mutation in the twentieth chromosome. The SNP related to this is rs74315403 [2].
|