BME103:W930 Group10 l2

BME 103 Fall 2012	Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help
OUR TEAM Name: Susan Sajadi Role(s) Name: Rachel Lundeen Role(s)Research and Development Name: Elizabeth Lopez Role(s) Name: Britny Sepulveda Role(s) Name: Raymond Feliciano Role(s) Name: Colin Siguenza Role(s) Name: Rotem Beger Role(s) Name: Lars Moss Role(s) LAB 2 WRITE-UP Thermal Cycler Engineering Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski. System Design Key Features PCR Block: The new design will be much larger, to include as many samples as possible to accomodate a standard classroom size. This includes a color coordinated tray. Benefit and Function- The color coordination will make it easier to keep track of the samples. The larger size will allow more students to participate Heat Sink/Fan: These pieces will be enlarged accordingly with the other parts of the device as necessary for the additional samples. The placement may also be shifted for this accommodation with smaller class sizes. Benefit and Function: Since this device is aimed at being educational, an important factor is price. It will be cheaper to use a larger device to accomodate more students. Instructions Protocols Materials Supplied in Kit Amount PCR Machine 1 Hydrophobic Slides 24 Plastic Phone Holder 8 Fluorimeter 8 Supplied By User Amount Smartphone with Camera 8 DNA Samples 16 Black Box 8 Green Dye 8 Computer 8 Image J Software 8 Open PCR 8 Test Tubes 16 Pippete 8 PCR Protocol DNA Measurement Protocol Research and Development Background on Disease Markers There are two diseases that our group decided to look into. The first disease is type II diabetes, which is the most common of the diabetes. The body does not produce enough insulin, which regulates the use of glucose, therefore leading to high levels of glucose in the blood. There is a mutation in the third chromosome which causes this disease. The SNP related to this is rs4402960 [1]. The second disease is insomnia. This is a sleeping disorder in which a person cannot fall asleep or stay asleep for as long as they would like. It is caused by a mutation in the twentieth chromosome. The SNP related to this is rs74315403 [2]. Primer Design Forward Primer for Type 2 Diabetes: GGACAGTAGATT[G/T]AAGATACTGATTGTGTTTGCAAACA Reverse Primer for Type 2 Diabetes: GGGCATGTTTGCAAACACAATCAGTATCTTAATCTACTGTCC Forward Primer for Insomnia: ACAGCAACCAGAACAACTTTGTGCAC[A/G]ACTGCGTCAATATCACAATCAAGCA Reverse Primer for Insomnia: Illustration