BME103:W930 Group10 l2

From OpenWetWare
Jump to navigationJump to search
The printable version is no longer supported and may have rendering errors. Please update your browser bookmarks and please use the default browser print function instead.
BME 103 Fall 2012 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help

OUR TEAM

Name: Susan Sajadi
Role(s)
Name: Rachel Lundeen
Role(s)Research and Development
Name: Elizabeth Lopez
Role(s)
Name: Britny Sepulveda
Role(s)
Name: Raymond Feliciano
Role(s)
Name: Colin Siguenza
Role(s)
Name: Rotem Beger
Role(s)
Name: Lars Moss
Role(s)

LAB 2 WRITE-UP

Thermal Cycler Engineering

Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.


System Design


Key Features
PCR Block: The new design will be much larger, to include as many samples as possible to accomodate a standard classroom size. This includes a color coordinated tray. Benefit and Function- The color coordination will make it easier to keep track of the samples. The larger size will allow more students to participate

Heat Sink/Fan: These pieces will be enlarged accordingly with the other parts of the device as necessary for the additional samples. The placement may also be shifted for this accommodation with smaller class sizes. Benefit and Function: Since this device is aimed at being educational, an important factor is price. It will be cheaper to use a larger device to accomodate more students.



Instructions





Protocols

Materials

Supplied in Kit Amount
PCR Machine 1
Hydrophobic Slides 24
Plastic Phone Holder 8
Fluorimeter 8
Supplied By User Amount
Smartphone with Camera 8
DNA Samples 1600 μL
Black Box 8
Green Dye 8 mL
Computer 8
Image J Software 8
Open PCR 1
Test Tubes 64
Pipettes 8
Reagent Volume
Template DNA (20 ng) 0.2 μL
10 μM forward primer 1.0 μL
10 μM reverse primer 1.0 μL
GoTaq master mix 50.0 μL
dH2O 47.8 μL
Total Volume 100.0 μL

PCR Protocol
The PCR machine is color coated by row. Each group of students is assigned a color, up to eight groups. The groups will then set up the Open PCR on the computer, plug in the PCR machine and turn it on. Then, the students will put the DNA samples into the tubes via the pipettes, using three different samples twice, a positive control, and a negative control. The students will then place their test tubes into their assigned colored row and the teacher will close the lid and start the program. Run this for two hours so that the PCR machine can amplify the DNA samples 30 times.

Flourimeter Setup:
1. Place the glass slide onto the device.
2. Turn on the blue light and move the slide to have the light positioned between two of the dots on the slide.
3. Place two drops of the dye and two drops of the samples spread over two of the dots on the slide. Make sure drops are placed over two dots vertically not horizontally or side by side.
4. Place the phone in the holder close enough to the device to get a close picture.
5. Place the box over the device and phone holder.
6. Close the box as much as possible and take picture.

DNA Measurement Protocol

Research and Development

Background on Disease Markers

There are two diseases that our group decided to look into. The first disease is type II diabetes, which is the most common of the diabetes. The body does not produce enough insulin, which regulates the use of glucose, therefore leading to high levels of glucose in the blood. There is a mutation in the third chromosome which causes this disease. The SNP related to this is rs4402960 [1]. The second disease is insomnia. This is a sleeping disorder in which a person cannot fall asleep or stay asleep for as long as they would like. It is caused by a mutation in the twentieth chromosome. The SNP related to this is rs74315403 [2].


Primer Design


Forward Primer for Type 2 Diabetes:
GGACAGTAGATT[G/T]AAGATACTGATTGTGTTTGCAAACA
Reverse Primer for Type 2 Diabetes:
GGGCATGTTTGCAAACACAATCAGTATCTTAATCTACTGTCC
Forward Primer for Insomnia:
ACAGCAACCAGAACAACTTTGTGCAC[A/G]ACTGCGTCAATATCACAATCAAGCA
Reverse Primer for Insomnia:



Illustration