BME103:W930 Group1 l2: Difference between revisions
Kevin M. Chu (talk | contribs) |
Kevin M. Chu (talk | contribs) |
||
Line 74: | Line 74: | ||
| Fluorimeter||1 | | Fluorimeter||1 | ||
|- | |- | ||
| Glass Slides|| | | Glass Slides||10 | ||
|- | |- | ||
| Black Box||1 | | Black Box||1 | ||
Line 84: | Line 84: | ||
| Negative Control Solution||1 sample (100.0μL) | | Negative Control Solution||1 sample (100.0μL) | ||
|- | |- | ||
| | | DNA Calf Thymus||1 sample (100.0μL) | ||
|- | |- | ||
| | | Transfer Pipettes||10 | ||
|- | |- | ||
| Tris Buffer (0.025% SYBR Green)|| | | Test Tubes (100μL)||8 | ||
|- | |||
| Eppendorf Tubes ||10 | |||
|- | |||
| Tris Buffer (0.025% SYBR Green)||4L | |||
|}<br> | |}<br> | ||
{| {{table}} | |||
| align="center" style="background:#f0f0f0;"|'''Supplied by the User''' | |||
| align="center" style="background:#f0f0f0;"|'''Amount''' | |||
|- | |||
| Smartphone||1 | |||
|- | |||
| Plastic Phone Holder||1 | |||
|- | |||
| Computer||1 | |||
|- | |||
| Open PCR Software||1 | |||
|- | |||
| ImageJ Software||1 | |||
|- | |||
| Sharpie (fine point)||1 | |||
|- | |||
| Distilled water||100.0μL | |||
|- | |||
| 500mL graduated cylinder||1 | |||
|}<br> | |||
Each DNA solution consists of<br> | Each DNA solution consists of<br> | ||
{| {{table}} | {| {{table}} | ||
Line 107: | Line 133: | ||
| Total||100.0μL | | Total||100.0μL | ||
|} | |} | ||
'''PCR Protocol''' | '''PCR Protocol''' | ||
Line 159: | Line 169: | ||
#Open the lid of the PCR machine, and remove the 8 samples from the PCR tray. | #Open the lid of the PCR machine, and remove the 8 samples from the PCR tray. | ||
#With the fine point Sharpie, label the transfer pipette and Eppendorf tubes accordingly to prevent contamination. | #With the fine point Sharpie, label the transfer pipette and Eppendorf tubes accordingly to prevent contamination. | ||
#Extract each sample with one pipette into an Eppendorf tube that contains 400mL of Tris buffer. Be sure to transfer all of the sample into the tube. Label the Eppendorf tube with the sample number. | #Measure 400mL of Tris buffer into a 500mL graduated cylinder and pour into each of the Eppendorf tubes. | ||
#Place | #Extract each sample with one pipette into an Eppendorf tube that contains 400mL of Tris buffer. Be sure to transfer all of the sample into the tube.<br> Label the Eppendorf tube with the sample number. | ||
#Next, unbutton one side of the black box, and lift the flap so that it rests on top of the box. Place the box upside down and position it so that the fluorimeter lies in the center of the box. | #Set up the sample DNA calf thymus by pipetting 100μL into an Eppendorf tube containing 400mL of Tris buffer. | ||
#Pipette 100μL of distilled water into the corresponding Eppendorf tube containing 400mL of Tris buffer. | |||
#Place a glass slide onto the fluorimeter. | |||
#Next, unbutton one side of the black box, and lift the flap so that it rests on top of the box. Place the box upside down and position it so that the<br> fluorimeter lies in the center of the box. | |||
#Turn on the fluorimeter so that a blue light shines. | #Turn on the fluorimeter so that a blue light shines. | ||
#From the labeled Eppendorf tubes containing SYBR green dye, use the corresponding pipette to place two drops adjacent to one another on a glass | #From the labeled Eppendorf tubes containing SYBR green dye, use the corresponding pipette to place two drops adjacent to one another on a glass slide.<br> The two drops should combine to form a single larger drop. | ||
#Dull the lights in the room, letting in as little light as possible into the box containing the fluorimeter. | #Dull the lights in the room, letting in as little light as possible into the box containing the fluorimeter. | ||
#On the Smartphone, adjust the following settings | #On the Smartphone, adjust the following settings | ||
Line 172: | Line 185: | ||
#*Maximize the saturation setting. | #*Maximize the saturation setting. | ||
#*Minimize the contrast setting. | #*Minimize the contrast setting. | ||
#From the labeled Eppendorf tubes containing SYBR green dye, use the corresponding pipette to place two drops adjacent to one another on a glass glide. The two drops should combine to form a single larger drop. | #From the labeled Eppendorf tubes containing SYBR green dye, use the corresponding pipette to place two drops adjacent to one another on a glass glide.<br> The two drops should combine to form a single larger drop. | ||
#Take an image of the fluorimeter and the drop, and record the image number and DNA sample. If desired, take another photograph of the drop. | #Take an image of the fluorimeter and the drop, and record the image number and DNA sample. If desired, take another photograph of the drop. | ||
#Repeat steps | #Repeat steps 7,10, and 13-14 for the 9 remaining DNA solutions using a different glass slide for each sample. | ||
#Once you have taken all of the pictures, download them onto the computer. | #Once you have taken all of the pictures, download them onto the computer. | ||
#Right click on the file name of the picture and open with Image J. | #Right click on the file name of the picture and open with Image J. | ||
Line 186: | Line 199: | ||
#Use a graphing program to generate a plot of INTDEN (with background subtracted) versus concentration. Select the option to display the linear equation. | #Use a graphing program to generate a plot of INTDEN (with background subtracted) versus concentration. Select the option to display the linear equation. | ||
#Use the linear equation and the INTDEN values of the samples to determine their concentrations. | #Use the linear equation and the INTDEN values of the samples to determine their concentrations. | ||
#Once the DNA concentrations of the positive and negative are known, you can determine whether samples give a positive or negative result for | #Once the DNA concentrations of the positive and negative are known, you can determine whether samples give a positive or negative result for heterotaxty. | ||
==Research and Development== | ==Research and Development== |
Revision as of 23:26, 27 November 2012
BME 103 Fall 2012 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
ProtocolsMaterials
Each DNA solution consists of
PCR Protocol
Research and DevelopmentBackground on Disease Markers Heterotaxty, (Hetero-different) (taxy-arrangement), syndrome is the most common birth defect that primary occurs in the heart. This syndrome is caused by the mutated gene, ZIC3. The reference number for this syndrome is rs104894962. This disease can also occur in other organs but it is less likely. With this syndrome, organs that are paired together have a mirror image of each other instead of having their own charcterstics. Other organs can also be arranged in a different order requiring major surgeries to aline the organs correctly. In some cases, organs or body parts may work incorrectly causing irregularity, worse infections, more recovery time, or lack of functioning correctly. This is not the only kind of the Heteotaxy however. As previously stated, the more common defects are located in the heart. Since most of the defects occur at birth, there is a varying type and severity. When the syndrome involves the heart, it is mainly because the heart sits to the right side of the chest instead of the left side. Web Link - http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=104894962
The sequence for the heterotaxy disease allele is CCTACACGCACCCGAGCTCCCTGCGC [A/G] AACACATGAAGGTAATTACCCCTTT, with the mutation occurring at the [A/G] site. When the A gene is expressed, the mutation occurs and heterotaxy is coded. When the G gene is expressed, there is no mutation and the gene expression is normal. Forward primer sequence (position 136,651,203 – 136,651,223, read left-right): TCCCTGCGCAAACACATGAA Reverse primer sequence (200 base pairs to the right, read right-left): TCCCAACTTTGCTCACTCCC A heterotaxy disease allele will show a PCR product because the disease allele will be amplified many times through the course of the chain reaction. Because a non-disease allele will not have a mutated expression of the A gene, it will not yield a PCR product and will instead amplify the healthy allele expression.
Illustration http://www.google.com/imgres?q=specific+amplification+of+heterotaxy&um=1&hl=en&client=safari&sa=N&tbo=d&rls=en&biw=1206&bih=684&tbm=isch&tbnid=3QBwBiTFWqfSZM:&imgrefurl=http://www.ipej.org/0802S/sreeram.htm&docid=7LM9Ij0u5jwLgM&imgurl=http://www.ipej.org/0802S/sreeram3.jpg&w=500&h=590&ei=tp2yUIuGDoPniwKmr4HYCw&zoom=1&iact=rc&dur=445&sig=104840076601863359039&page=1&tbnh=128&tbnw=121&start=0&ndsp=26&ved=1t:429,r:4,s:0,i:99&tx=59&ty=47 |