OUR TEAM
Name: Kevin Chu Experimemtal Protocol Planner
|
|
|
|
|
|
|
LAB 2 WRITE-UP
Thermal Cycler Engineering
Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
System Design

The picture shown above is the top of the Open PCR machine. This part consists of a LCD screen and a heating lid.
Key Features
Our group focuses on the stability of the machine. First of all, many groups have reported that the lid was hard to open. Since the problem is mainly caused by the current latch, the latch will be changed to a magnetic latch, which can be readily opened. Secondly, the machine is heavy and hard to carry around. In order to solve this problem, we can use transparent plastic instead of wood to make the case. Through this change, we can not only reduce the weight but also see the inner design of the machine easily. Last but not least, we can make the lid removable. This change is made to make sure we still have the access to the inner parts if repairs are needed.
Instructions
Protocols
Materials
| Supplied in the Kit
| Amount
|
| PCR Machine | 1
|
| PCR Power Adapter | 1
|
| USB 2.0 Cable | 1
|
| Fluorimeter | 1
|
| Glass Slide | 1
|
| Black Box | 1
|
| DNA Solution | 6 samples (600.0μL)
|
| Positive Control Solution | 1 sample (100.0μL)
|
| Negative Control Solution | 1 sample (100.0μL)
|
| Transfer Pipettes | 8
|
| Tubes | 8
|
| 0.025% Tris Buffer | TBD
|
Each DNA solution consists of
| DNA Solution Component
| Amount
|
| Patient’s Template DNA | 0.2μL
|
| 10μM forward primer | 1.0μL
|
| 10μM reverse primer | 1.0μL
|
| GoTaq master mix | 50.0μL
|
| dH2O | 47.8μL
|
| Total | 100.0μL
|
Note that that positive control is calf thymus DNA, and the negative control is a blank solution of water.
| Supplied by the User
| Amount
|
| Smartphone | 1
|
| Plastic Phone Holder | 1
|
| Computer | 1
|
| Open PCR Software | 1
|
| ImageJ Software | 1
|
| Sharpie (fine point) | 1
|
PCR Protocol
- On your computer, download the Open PCR software.
- Place the PCR machine on a sturdy desk where it is unlikely to be disturbed, and turn on the machine.
- After turning on the Open PCR machine, plug it into an electrical outlet by using the power adapter provided in the kit.
- Connect the Open PCR machine to your computer by using the USB 2.0 cable.
- Create a new program on OpenPCR by clicking on “Add a new experiment.”
- Click on the “more options” button.
- Click on the plus symbol next to initial step, and type 95°C for temperature and 180 seconds for time.
- In the third section, type in 30 for the number of cycles.
- Set the denaturing temperature to 95°C and time to 30 seconds.
- Set the annealing temperature to 57°C and time to 30 seconds.
- Set the extending temperature to 72°C and time to 30 seconds.
- Add a final step. Set the temperature to 72°C and the time to 180 seconds.
- Set the final hold to 4°Cs.
- Use one pipette to transfer one of the extracted DNA samples into one of the PCR test tubes.
- Next, add the forward and reverse primers to the test tube, using different pipettes for each.
- Then, use another pipette to transfer GoTaq master mix into the DNA/primer mixture.
- Dilute the contents of the test tube by filling its remainder with deionized water.
- Repeat steps 5-9 for each of the seven remaining DNA samples including the positive and negative controls using different pipettes to transfer
each substance.
- Place the 8 test tubes including the positive and negative controls into the Open PCR machine, and close the lid and tighten the screw so that it
barely touches the tops of the tubes.
- Using a fine point Sharpie, label each of the test tubes. Number the experimental DNA samples from 1 to 6, and label the positive and negative
controls accordingly.
- Click on “Plug in Open PCR to start” to begin amplifying DNA samples.
- Carefully observe the display screen on the lid of the Open PCR with the quantities that appear on the computer.
- If these quantities are close, then continue running the program.
- If these quantities are not close, then discontinue the program and try again.
- Run the program for two hours to allow the PCR machine to amplify DNA 30 times. Ensure that all of the components are functioning properly.
DNA Measurement Protocol
Research and Development
Background on Disease Markers
Heterotaxty, (Hetero-different) (taxy-arrangement), syndrome is the most common birth defect that primary occurs in the heart. This syndrome is caused by the mutated gene, ZIC3. The reference number for this syndrome is rs104894962. This disease can also occur in other organs but it is less likely. With this syndrome, organs that are paired together have a mirror image of each other instead of having their own charcterstics. Other organs can also be arranged in a different order requiring major surgeries to aline the organs correctly. In some cases, organs or body parts may work incorrectly causing irregularity, worse infections, more recovery time, or lack of functioning correctly. This is not the only kind of the Heteotaxy however. As previously stated, the more common defects are located in the heart. Since most of the defects occur at birth, there is a varying type and severity. When the syndrome involves the heart, it is mainly because the heart sits to the right side of the chest instead of the left side.
Web Link - http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=104894962
Primer Design
The sequence for the heterotaxy disease allele is CCTACACGCACCCGAGCTCCCTGCGC [A/G] AACACATGAAGGTAATTACCCCTTT, with the mutation occurring at the [A/G] site. When the A gene is expressed, the mutation occurs and heterotaxy is coded. When the G gene is expressed, there is no mutation and the gene expression is normal.
Forward primer sequence (position 136,651,203 – 136,651,223, read left-right): TCCCTGCGCAAACACATGAA
Reverse primer sequence (200 base pairs to the right, read right-left): TCCCAACTTTGCTCACTCCC
A heterotaxy disease allele will show a PCR product because the disease allele will be amplified many times through the course of the chain reaction. Because a non-disease allele will not have a mutated expression of the A gene, it will not yield a PCR product and will instead amplify the healthy allele expression.
Illustration
http://www.google.com/imgres?q=specific+amplification+of+heterotaxy&um=1&hl=en&client=safari&sa=N&tbo=d&rls=en&biw=1206&bih=684&tbm=isch&tbnid=3QBwBiTFWqfSZM:&imgrefurl=http://www.ipej.org/0802S/sreeram.htm&docid=7LM9Ij0u5jwLgM&imgurl=http://www.ipej.org/0802S/sreeram3.jpg&w=500&h=590&ei=tp2yUIuGDoPniwKmr4HYCw&zoom=1&iact=rc&dur=445&sig=104840076601863359039&page=1&tbnh=128&tbnw=121&start=0&ndsp=26&ved=1t:429,r:4,s:0,i:99&tx=59&ty=47
|