BME103:W930 Group2

From OpenWetWare
Jump to navigationJump to search
BME 103 Fall 2012 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help

OUR TEAM

Name: Garrett Salcido
Open PCR machine engineer
Name: Matt Mortensen
Open PCR machine engineer
Name: Ramesh Tadayon
Experimental protocol planner
Name: Alanie Harmon
Experimental protocol planner
Name: Alex Torres
R&D Scientist
Name: Davey Rand
R&D Scientist

LAB 1 WRITE-UP

Initial Machine Testing

The Original Design
OpenPCR Machine


Experimenting With the Connections

When we unplugged part (part 3) from (part 6), the machine ... (did what? fill in your answer)

When we unplugged the white wire that connects (part 6) to (part 2), the machine ... (did what? fill in your answer)


Test Run

(Write the date you first tested Open PCR and your experience(s) with the machine)




Protocols

Polymerase Chain Reaction

How PCR Works: Step 1: Denaturation by Heat: Initially, heat separates a DNA strand into two separate strands. This is allowed because the hydrogen bonds holding the DNA together are weak and easily separable when heated. Step 2: Annealing Primer to Target Sequence: We want to target a sequence specifically and to do that you must use primers. Primers mark the ends of the target sequence. Two primers are included in the PCR one for each of the strands that were just separated during denaturation. The beginning of the DNA target sequence is also marked by the primers that bind (anneal) to the complementary sequence. Step 3: Extension: After the primers bind to the complementary DNA, the temperature is raised and the enzyme Taq DNA polymerase is used to replicate the strands. The Taq DNA polymerase, active at high temperatures, facilitates the binding and joining of the complementary nucleotides. It synthesizes an identical double-stranded DNA strand. Extension begins at the 3’ end of the primer because Taq DNA polymerase synthesizes exclusively in the 5’ to 3’ direction, so the free nucleotides are only added to the 3’ end of the primer.

How to Amplify a Patient’s DNA sample 1. A PCR Machine is created to amplify a patient’s DNA sample. In order to use a PCR machine, the steps include to first gather the DNA samples, 50 μL each. 2. The frozen DNA samples are separated into tubes and once melted, 8 transfer pipettes were used to add primer. 3. Once the samples are ready, we processed the DNA in the openPCR system.


Components of the PCR master mix-400μM dATP, 400μM dGTP, 400μM dCTP, 400μM dTTP and 3mM MgCl2, reaction buffer (pH 8.5), nuclease-free water

Flourimeter Measurements

Fluorimeter set up



Fluorimeter assembly procedure- Turn on the excitation light on the fluorimeter. Put a smart phone in the cradle and set it up to take pictures of the slide. Place two drops of water in the middle of the first two rows of the slide using a pipette. Align the drop by moving the slide so the drop is in the middle of the black fiber optic fitting. Cover the fluorimeter with the light box while still being able to use the smart phone to take pictures.


How to open images in Image J- Save the pictures to the phone. Download the pictures onto a computer that has Image J. Open them with Image J by going to add image.

Research and Development

Specific Cancer Marker Detection - The Underlying Technology

Cancer Associated with the gene: Breast and Colorectal cancer with a susceptibility to LiFraumeni Syndrome
Chromosome: 22
Gene being analyzed: CHEK2
SNP #: 17879961
SNP's Surrounding DNA: 29,121,087
Cancer-Sequence Primer: TTGAGAATGTGACGTATGTA
"Partner Primer": 29,121,080

"In response to DNA damage and replication blocks, cells prevent cell cycle progression through the control of critical cell cycle regulators. To investigate checkpoint conservation, Matsuoka et al. (1998) used PCR and database analysis to identify CHK2, the mammalian homolog of Saccharomyces cerevisiae Rad53 and Schizosaccharomyces pombe cds1+, protein kinases required for DNA damage and replication checkpoints. The longest human cDNA encoded a 543-amino acid protein with 83% identity to mouse Chk2 and 34% identity to Drosophila Dmnk, a protein highly expressed in ovaries for which a function in meiosis had been suggested. Human CHK2 protein is 26% identical to Rad53 and 26% identical to cds1+. Sequence analysis revealed a single forkhead-associated (FHA) domain, a 60-amino acid protein interaction domain essential for activation in response to DNA damage that is conserved in the Rad53/cds1+ family of kinases. CHK2 has a potential regulatory region rich in SQ and TQ amino acid pairs. Northern blot analysis revealed wide expression of small amounts of CHK2 mRNA with larger amounts in human testis, spleen, colon, and peripheral blood leukocytes. CHK2 complemented the lethality of a Rad53 deletion." - Omim.org

Normal Gene Sequence:
GGAAGTGGGTCCTAAAAACTCTTACA[T]TGCATACATAGAAGATCACAGTGGC

Cancer Gene Sequence:
GGAAGTGGGTCCTAAAAACTCTTACA[C]TGCATACATAGAAGATCACAGTGGC

Baye's Rule:
p(C|hc) = 7.8% C's found in cancer patients
p(hc) = 2.5%
p(C) = 5.3% C's in Finland



Results


Description--------INTDEN Subtracted Background----------DNA Concentration (micrograms/mL)

Water Blank----------218527------------------------------- 0
DNA Calf Thymus------6369082----------------------------- 2
Buffer A--------------1193961-------------------------------0
Buffer B --------------5237029 --------------------------- 1.1
Buffer C ----------------5437872---------------------------- 1.2
Buffer D -----------------10726518 --------------------------- 4
Buffer 1-----------------2711977 ---------------------------- 0.7
Buffer 2------------------7637000----------------------------- 2.2
Buffer 3 ----------------1440716------------------------------0.5
Buffer 4-----------------2814775------------------------------ 0.8