BME103:W930 Group3 l2: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
Line 42: Line 42:


'''Instructions'''<br>
'''Instructions'''<br>
Instructions for our new Open PCR Machine will be very similar to the original "Open PCR Building Instructions" with slight modifications.
Instructions for our new Open PCR Machine will be very similar to the original "Open PCR Building Instructions" with slight modifications. The only changes that will need to be made to the original instructions will describe how to install the new plexi-glass side of the lid.  


<!--- From Week 4 exercise --->
<!--- From Week 4 exercise --->

Revision as of 23:55, 27 November 2012

BME 103 Fall 2012 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help

Our Team

Name: Ryan Bath
Role(s) Open PCR Machine Engineer
Name: Geon-Woo Kim
Role(s) Experimental Protocol Planner
Name: Troy Kozlowski
Role(s) Open PCR Machine Engineer
Name: Phillip Mercado
Role(s) Experimental Protocol Planner
Name: Eliza Normen
Role(s) R&D Scientist
Name: Jacob Swartz
Role(s) R&D Scientist

LAB 2 WRITE-UP

Thermal Cycler Engineering

Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.


System Design


New Lid Catch


Key Features
The redesigned version of the Open PCR system focused on resolving the issues that surrounded the function of the Open PCR machine's lid. One modification made was the changing of materials used in production of the PCR lid. In the original design of this machine wood was the main structural material of the Open PCR's lid; however,this redesign changes the material used on the sides of the lid from wood to plexi-glass. The use of plexi-glass allows for the user to see into the lid of the Open PCR machine.In turn allowing the user to view the height of the heat plate while adjusting it, this then minimizes the the chance of the user crushing the DNA samples while lowering the heat plate. The other modification present in the redesign was that the magnetic clasp from the original design was replace by spring catch. The original magnetic clasp on the PCR required too much force to open. While this magnet prevented the lid to open mistakenly during an experiment, it made the machine vulnerable to breakage when the lid needed to be opened. The newly added catch provides the same amount of protection in terms of mistaken lid opening but it also increases ease of use and limits the chance of breakage while opening the lid.


Instructions
Instructions for our new Open PCR Machine will be very similar to the original "Open PCR Building Instructions" with slight modifications. The only changes that will need to be made to the original instructions will describe how to install the new plexi-glass side of the lid.




Protocols

Materials List of Required Materials for PCR & DNA measurements


Supplied in the Kit Amount
Cyber-Green 1 Dye diluted with buffer ~~
2 ~~
3 ~~
4 ~~
5 ~~
6 ~~
7 ~~
8 ~~
9 ~~
10 ~~
11 ~~
12 ~~
Supplied by User Amount
1 ~~
2 ~~
3 ~~
4 ~~
5 ~~
6 ~~
7 ~~
8 ~~
9 ~~
10 ~~
11 ~~
12 ~~

PCR Protocol

Step 1)

Step 2)

Step 3)

Step 4)

Step 5)

Step 6)

Step 7)

DNA Measurement Protocol Step 1)

Step 2)

Step 3)

Step 4)

Step 5)

Step 6)

Step 7)

Step 8)

Research and Development

Background on Disease Markers
The marker that we investigated is associated with Alzheimer's Disease. Alzheimer's disease is a degenerative brain disease that impairs memory, thinking, and behavior. It affects chromosome 21 and its SNP is rs63751263.link to NCBI webpage It affects the APP gene also known as the amyloid beta (A4) precursor protein. The mutation affects the gene like so: ATG=>CTG.



Primer Design
Reverse Primer: GTCGAAGTGAAGTCTCTAGA
Forward Primer: TAGCCTATTTATTTTCTTCA



Illustration