BME103:W930 Group4: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
(3 intermediate revisions by the same user not shown)
Line 13: Line 13:
{| style="wikitable" width="700px"
{| style="wikitable" width="700px"
|- valign="top"
|- valign="top"
| [[Image:BME103student.jpg|100px|thumb|Name: Renaad Alawi<br>Experiemental Protocol Planner]]
| [[Image:Renaad_Alawi.jpg|100px|thumb|Name: Renaad Alawi<br>Experiemental Protocol Planner]]
| [[Image:Lauren_Allison.jpg|100px|thumb|Name: Lauren Allison<br>Research and Development]]
| [[Image:Lauren_Allison.jpg|100px|thumb|Name: Lauren Allison<br>Research and Development]]
| [[Image:Jake_Krammer.jpg|100px|thumb|Name: Jake Krammer<br>Open PCR Machine]]
| [[Image:Jake_Krammer.jpg|100px|thumb|Name: Jake Krammer<br>Open PCR Machine]]
Line 98: Line 98:
<br>''Fluorimeter Assembly Procedeure:''<br>
<br>''Fluorimeter Assembly Procedeure:''<br>
1)Use multiple pipettes to put two drops of dye and two drops of the sample on a glass slide.<br>
1)Use multiple pipettes to put two drops of dye and two drops of the sample on a glass slide.<br>
2)Do not use the same pipette for each sample.<br>
2)label each pipette so that you don't use the same one for each sample.<br>
3)Place the glass slide with th drops on the device.<br>
3)Place the glass slide with th drops on the device.<br>
4)Turn on the blue LED light.<br>
4)Turn on the blue LED light.<br>
Line 104: Line 104:
6)Place a box on top of the device and smartphone to create a dark environment.<br>
6)Place a box on top of the device and smartphone to create a dark environment.<br>
7)Take a close clear picture of the drop.<br>
7)Take a close clear picture of the drop.<br>
8)Make sure the pictures are clear by turning off the flash and placing the smartphone holder as close as possible to the device.<br>
8)Make sure the pictures are clear by turning off the flash and placing the smartphone holder as close as possible to the devicelso make sure the phone is at the same position each time.<br>


<br> ''Opening Images in Image J:'' <br>
<br> ''Opening Images in Image J:'' <br>

Revision as of 11:45, 14 November 2012

BME 103 Fall 2012 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help

OUR TEAM

Name: Renaad Alawi
Experiemental Protocol Planner
Name: Lauren Allison
Research and Development
Name: Jake Krammer
Open PCR Machine
Name: Jan Simper
Open PCR Machine
Name: Justus Vangor
Research and Development
Name: Christian Vargas
Experimental Protocol Planner

LAB 1 WRITE-UP

(Please finish by 11/7/2012)

Initial Machine Testing

The Original Design
The Polymerase Chain Reaction(PCR) machine essentially tests sequences of DNA for variations in nucleotides. This simple device is portable, easy to use, and relatively inexpensive. The LCD screen provides information on what step of the reaction is currently taking place. The heating lid heats up the samples contained within the sample holder, allowing the reaction to occur. The circuit board allows the fan, the heater, and the LCD screen to all run efficiently by connecting their wires to a central area. The PCR Machine is able to test up to 16 samples of DNA at a time and can be connected to a computer for ease of use. The machine heats up DNA samples so the samples disassociate allowing a primer to connect to the sequences of DNA and then the machine cools the DNA samples down with the primer in place.

Experimenting With the Connections

When the mounting plate was unplugged from the circuit board, the machine the LCD light and the menu on the PCR machine shut off.

When the white wire that connects the circuit board to the sample holder was unplugged, the temperature on the menu on the PCR machine dropped from room temperature to -40.0 degrees Celsius. The conclusion is that the white wire was the temperature sensor wire.


Test Run The date the OpenPCR Machine #4 was first tested was October 24, 2012. The test tubes were put into the machine and the handle was secured over them. There was a little difficulty in determining when to stop turning the handle. The software itself was simple and easy to use and there were no problems in running the OpenPCR software. After the reaction was complete, the tubes were taken out, labeled, and stored in a refrigerated area.




Protocols

Polymerase Chain Reaction

The Polymerase Chain Reaction works by amplifying DNA through the use of a PCR machine and therefore producing a multitude of copies of DNA sequences. These copies can then be further studied to diagnose hereditary and infectious diseases, such as cancer and HIV.

Thermal Cycling Process:
1)The DNA is first heated to 95 degrees Celsius which will in turn unzip the DNA to expose its bases and create two one-stranded strips
2)After primer is added to the solution, the DNA is then cooled down to 57 degrees Celsius so that the said primer can attach to a template sequence to form a forward primer.
3)The DNA is then once more heated to 72 degrees Celsius so that the replication process can be completed.
4)This process is repeated 30 more times to acquire a greater number of DNA samples.

PCR Master Mix Components:
-GoTaq® Colorless Master Mix, 2X 25μl
-upstream primer 10μM
-downstream primer 10μM
-DNA template 1–5μl
-Nuclease-Free Water to 50μl

Reagent Volume
Template DNA (20 ng) 0.2 µL
10 µM Forward Primer 1.0 µL
10 µM Reverse Primer 1.0 µL
GoTaq Master Mix 50.0 µL
dH2O 47.8 µL
Total Volume 100.0 µL


Patient Sample Descriptions:
Positive Control: Cancer DNA Template
Negative Control: DNA Template
Patient 1, Replicates(1,2,3):
ID: 80175
Gender: Female
Age: 59
Patient 2, Replicates(1,2,3):
ID: 57483
Gender: Male
Age: 56


Fluorimeter Measurements

Fluorimeter Assembly Set-Up

Fluorimeter Assembly Procedeure:
1)Use multiple pipettes to put two drops of dye and two drops of the sample on a glass slide.
2)label each pipette so that you don't use the same one for each sample.
3)Place the glass slide with th drops on the device.
4)Turn on the blue LED light.
5)Place the smartphone on the holder provided and position them in front of the device.
6)Place a box on top of the device and smartphone to create a dark environment.
7)Take a close clear picture of the drop.
8)Make sure the pictures are clear by turning off the flash and placing the smartphone holder as close as possible to the devicelso make sure the phone is at the same position each time.


Opening Images in Image J:
1)Using the android phone, email the pictures taken from the phone to the email of the ImageJ Software Operator.
2)Open the email of the ImageJ Operator and save the pictures onto the computer of the ImageJ Software Operator.
3)Open up the ImageJ Software.
4)Click File > Open.
5)Then select the images from wherever they were saved on the computer.
6)Click open and the image should appear in the program.




Research and Development

Specific Cancer Marker Detection - The Underlying Technology

What is the function of each component of a PCR reaction?

Template DNA: A double-stranded segment of DNA that encodes either a cancerous gene or a normal gene

Primers: Short segments of DNA that bind to a specific sequence of nucleotides (binds to cancer gene)

Taq Polymerase: A protein that serves as the catalyst for the DNA replication; grabs extra nucleotides within the solution and binds them to the "unzipped" strands

Magnesium Chloride: A cofactor that binds to the Taq Polymerase and affects the speed of the reaction; positive correlation between amount of magnesium chloride and reaction speed

dNTP's: Deoxynucleotide triphosphates; extra nucleotide bases in solution that are able to be grabbed and synthesized by Taq Polymerase to replicate DNA strands beyond the primer sequence


What happens during each step of thermal cycling?

• At 95° Celsius: DNA melts and "unzips" to create two one-stranded strips, primers are added to the solution

• At 57°Celsius: Primers attach to the corresponding template sequence they complement, forming one forward primer and one reverse primer

• At 72° Celsius: Taq Polymerase finishes the replication process with the use of dNTP's and magnesium chloride


Why does a cancer gene produce a positive result while a normal gene produces a negative?

• Because the cancer gene has the specific sequence of nucleotides that the primers can bond to, the process can continue and the DNA can be replicated; however, since the normal gene does not include that specific sequence, the primers can never bond to the strands and the process cannot take place.

Specific to this cancer gene:

The reverse primer that should bond to the cancer gene is AACTCTTACACTGCATACAT. The forward primer that should bond to the cancer gene is GTATAAGACATTCCTGTCCT (200 bp away from reverse)


Relation to Bayes' Rule:

In order to achieve accuracy of the amplification process as an actual determinant for cancer, Bayes' Rule must be used. This will compute the probability of true positives in coordination with false positives and false negatives to give a realistic prediction for how reliable the PCR process is in detecting the true cancer patients.

Specific to this cancer gene:

Approximately 1.1% of people have the C/T variation

p (hc|C) = p(C|hc) p(hc) / p(C)

where p(C)=5% and p(hc|C)=7.8%

Image Credit to OpenPCR.org/use-it/



Results

Sample Integrated Density DNA μg/mL Conclusion
PCR: Negative Control 2773313 0 Negative for gene
PCR: Positive Control 26759481 2 Positive for gene
PCR: Patient 1 ID 80175, rep 1 17085185 1.27694 Positive for gene
PCR: Patient 1 ID 80175, rep 2 12388707 0.92593 Positive for gene
PCR: Patient 1 ID 80175, rep 3 4620549 0.345339 Negative for gene
PCR: Patient 2 ID 57483, rep 1 16031260 1.19817 Positive for gene
PCR: Patient 2 ID 57483, rep 2 11636055 0.869677 Positive for gene
PCR: Patient 2 ID 57483, rep 3 18928511 1.41471 Positive for gene


KEY

  • Sample = A sample is a set of DNA contained within one plastic tube.
  • Integrated Density = Integrated density is an extensive quantity. It is the sum of the values of the pixels in the image or selection equivalent to the product of the area and mean gray value. We subtracted the integrated density of the background from the integrated density of our sample to obtain our data.
  • DNA μg/mL = The concentration was obtained by dividing the integrated density of the sample with the background subtracted by the integrated density of the positive control with the background subtracted and multiplying by 2.
  • Conclusion = Whether or not the sample was positive for the cancer gene.