BME103:W930 Group6 l2: Difference between revisions
Line 145: | Line 145: | ||
[[Image:Prob-conditional-formula2.gif|200px|]] | [[Image:Prob-conditional-formula2.gif|200px|]] | ||
The relevance within Bayesian Stats is seen with the outcome of previous experiments to conclude a promising route when devising a new experiment using relatively the same equipment and testing methods. Withing the Bayesian statistics a percentage is given to guide the users on the accuracy of the experiment about to be attempted to give a good indication for what the results of the experiment will yield. Overall Bayesian statistics are especially useful when trying to get a statistical reading for the pros and cons of the certain tests throughout the experimentation period. | |||
Revision as of 01:42, 28 November 2012
BME 103 Fall 2012 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||
OUR TEAMLAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
Key Features (Content by Sairah F) Instructions (Content by Sairah F)
ProtocolsMaterials Supplied in the Kit ---- Amount Supplied by User-----Amount
Fluorometer Use Research and DevelopmentBackground on Disease Markers This experiment heavily employs the use of PCR, or polymerase chain reaction. This process is used to amplify a segment of DNA for in-depth analysis. The process starts by adding a mix of DNA primers and DNA florescent tags that bind to a specific segment of DNA. After these primers bind, DNA polymerase binds to the primer-DNA strand bond and incorporates the florescent tags into the molecule. The polymerase adds base pairs to the base DNA strand and creates an antisense copy of the original strand. Since this process happens for both strands of the DNA, each process essentially duplicates the DNA strand. In order for this reaction to occur, the solution needs to be heated up to allow the double stranded DNA to melt into single strands. Then the solution needs to cool down and let the DNA anneal. Each one of these heating and cooling steps makes up the process of thermal cycling. Each cycle the DNA is replicated once. The sample is run through anywhere between 30 and 50 cycles in order to amplify the DNA and the targeted signal enough to be picked up by an imaging machine. Since the primers only bind to specific segments of DNA, the sample will only light up when the segment of interest is duplicated. In this lab, the SYBER green dye colored the DNA in solution, only fluorescing when bonded to double-stranded DNA. As a result, PCR can be used to identify the presence or absence of a particular DNA sequence. (content by William L.)
The DNA sequence surrounding the rs17879961 appears as follows, with the nucleotide switch in the brackets: 5' GGAAGTGGGTCCTAAAAACTCTTACA[C/T]TGCATACATAGAAGATCACAGTGGC 3' In order to isolate this specific segment, two specific primers are required. The forward primer coding from the 5’ to the 3’ end of the DNA has the following sequence: 3' CCTTCACCCAGGATTTTTGAG 5' The backward primer that attaches to the other strand of the DNA has the following sequence: 3' ATGTATCTTCTAGTGTCACCG 5' Both of these primers follow the standards for effective primers, having an annealing temperature of 61 degrees Celsius for the forward-generated strand and 59 degrees Celsius for the backward-generated strand. (content by William L.)
Illustration
The relevance within Bayesian Stats is seen with the outcome of previous experiments to conclude a promising route when devising a new experiment using relatively the same equipment and testing methods. Withing the Bayesian statistics a percentage is given to guide the users on the accuracy of the experiment about to be attempted to give a good indication for what the results of the experiment will yield. Overall Bayesian statistics are especially useful when trying to get a statistical reading for the pros and cons of the certain tests throughout the experimentation period.
|