OUR TEAM
Name: Antonio Experimental Protocol Planner
| Name: William Machine Engineer
| Name: Saraih Machine Engineer(s)
|
|
|
|
|
LAB 2 WRITE-UP
Thermal Cycler Engineering
Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
System Design

Key modifications to the standard OpenPCR setup include an extended load capacity and increased dimensions to accommodate the additional heating blocks.
Key Features
Our group decided to increase the sample size. We increased it to 48 samples. We designed our Open PCR machine to include this increased sample size. We increased the size of the machine itself to be able to hold 2 more heating plates and lids. We changed the overall shape of the machine to make it wider to include the new heating plates on one of the sides. The controls and the machine itself run in the same way. This would benefit in diagnosing diseases more quickly across multiple patients.
(Content by Sairah F)
Instructions
Building the Heating Lid
1. Peel off the backing paper on all 5 wooden parts.
2. Snap together one of side pieces into the top piece.
3. Pick up a small metal nut. Slide the nut into the “T” cross of the side pieces. (Line up the edges of the nut to be parallel with the cross.)
4. Put a metal screw through the hole. Tighten using your fingers at first. Finish it off with your blue Allen wrench.
5. Repeat steps 2-4 to attach the three other side pieces.
6. When all four wooden sides are attached, then put a metal screw through each hole and tighten.
7. Repeat steps for the other heating lids.
Building the Heating Lid Part 2
1. Find the orange lid heater and small rectangular lid plate. Remove the adhesive backing on the orange lid heater.
2. Stick the heater in the middle of the plate. Make sure the orange heater does not hang off the edges, cover up any holes or have any bubbles underneath.
3. Remove the adhesive backing on the white insulation. Stick to the top of the lid heater.
4. Repeat steps for the other heating lids.
Building the Heating Lid Part 3
1. Screw the latch onto the heated lid bracket using 2 short Philips head screws.
2. Screw the hinge to the back of the heated lid bracket with 2 black Philips head screws.
3. Find the small 2 mm black Allen wrench. Place a spring around the shoulder bolt and screw it on to hold the plates together.
4. Repeat with the other 3 shoulder bolts.
5. Repeat steps for the other heating lids.
(Content by Sairah F)
Protocols
Materials
Supplied in the Kit ---- Amount
10 μM Reverse Primer---7.5μL
10 μM Forward Primer---7.5μL
GoTaq master mix--------360μL
dH2O---------------------------360μL
Total Volume--------------750μL
Supplied by User-----Amount
Sample of DNA----------.5μL
Safety Gloves
Lab Coat
Computer/Program to run PCR/Image J
PCR Protocol
DNA Measurement Protocol
Fluorometer Setup 1. Remove fluorometer elements from container. 2. Place smartphone into the black stand, creating the camera setup. 3. Position camera setup parallel to the LED box so that the camera is shooting along the channel of the LED box.
4. Place Fluorometer Setup Part I onto lid from original container 5. While leaving the camera setup side of the container unsnapped, place container around Fluorometer Setup Part I.
Fluorometer Use 1. Remove container covering Fluorometer Final Setup. 2. Switch on blue LED. 3. Change camera settings by turning flash on, setting ISO to 800+, increasing exposure to maximum and disabling auto-focus. 4. Pipette two drops of water (volume of 130-160 microliters per drop) onto the slide in the channel of the LED box. 5. Focus LED light on the drops so that the middle of the drop is aligned with the line of light created by the LED. 6. Put the container covering back over the Fluorometer Final Setup. 6. Take 3 photos, making sure not to disturb the positioning and setup. 7. Remove the container covering while again taking care not to change the placement of the setup. 8. Remove slide and dispose of the used slide. 9. Place new slide into LED box, and do steps 4 through 6 again. 10. Note the type of smartphone used throughout the protocol, the distance from smartphone to the base of the LED box (in centimeters), and attach an image of each position of the drops.
Transferal of Fluorometer Data to ImageJ 1. Use a USB cable to connect the smartphone that was used to a computer with the ImageJ software. 2. Open the Start Menu and double click on My Computer or Computer. 3. Select Portable Devices where the smartphone should be listed and double-click the icon. 4. Locate the DCIM folder and open it, and continue to the sub-folder Camera. 5. Select each picture that needs to be transferred, then Copy and Paste them into the folder you choose to store them in. 6. Open ImageJ software from Start Menu or by double-clicking the ImageJ icon on the Desktop. 7. Once ImageJ software is open, click on File and select Open in the toolbar located in the top left of the computer screen. 8. Select Browse then select the image you want out of the folder where you stored your photos (in step 5) 9. Repeat steps 7 and 8 to continue process with different pictures.
Research and Development
Background on Disease Markers
This experiment heavily employs the use of PCR, or polymerase chain reaction. This process is used to amplify a segment of DNA for in-depth analysis. The process starts by adding a mix of DNA primers and DNA florescent tags that bind to a specific segment of DNA. After these primers bind, DNA polymerase binds to the primer-DNA strand bond and incorporates the florescent tags into the molecule. The polymerase adds base pairs to the base DNA strand and creates an antisense copy of the original strand. Since this process happens for both strands of the DNA, each process essentially duplicates the DNA strand. In order for this reaction to occur, the solution needs to be heated up to allow the double stranded DNA to melt into single strands. Then the solution needs to cool down and let the DNA anneal. Each one of these heating and cooling steps makes up the process of thermal cycling. Each cycle the DNA is replicated once. The sample is run through anywhere between 30 and 50 cycles in order to amplify the DNA and the targeted signal enough to be picked up by an imaging machine. Since the primers only bind to specific segments of DNA, the sample will only light up when the segment of interest is duplicated. In this lab, the SYBER green dye colored the DNA in solution, only fluorescing when bonded to double-stranded DNA. As a result, PCR can be used to identify the presence or absence of a particular DNA sequence.
(content by William L.)
Primer Design
The DNA sequence surrounding the rs17879961 appears as follows, with the nucleotide switch in the brackets:
5' GGAAGTGGGTCCTAAAAACTCTTACA[C/T]TGCATACATAGAAGATCACAGTGGC 3'
In order to isolate this specific segment, two specific primers are required. The forward primer coding from the 5’ to the 3’ end of the DNA has the following sequence:
3' CCTTCACCCAGGATTTTTGAG 5'
The backward primer that attaches to the other strand of the DNA has the following sequence:
3' ATGTATCTTCTAGTGTCACCG 5'
Both of these primers follow the standards for effective primers, having an annealing temperature of 61 degrees Celsius for the forward-generated strand and 59 degrees Celsius for the backward-generated strand.
(content by William L.)
Illustration
Bayesian Stats
|