BME103:W930 Group7 l2

BME 103 Fall 2012	Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help
OUR TEAM Name: Jake Turner PCR Machine Engineer Name: Tyler Allen PCR Machine Engineer, Graphic Designer Name: Khalil Pathan Experimental Protocol Planner Name: Pahul Singh Experimental Protocol Planner Name: Frea Mehta Research and Development Specialist Name: Paul Song Research and Development Specialist LAB 2 WRITE-UP Thermal Cycler Engineering Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski. System Design While the system proved to be useful in previous experiments, many setbacks occurred due to the physical restraints of the devise. The overall design had many advantages (i.e. low cost, portable, user friendly) but small parts of the system needed adjustments in order to operate on an acceptable level. Troubles we encountered included a long wait time for the system to cool to the necessary temperatures, difficulty opening the latch for the lid, and the restrictive sample size. Key Features Instructions Protocols Materials Supplied in the Kit Amount Open PCR 1 Primers USB Cable 1 Standardized Mat with Measurements 1 Fluorimeter 1 Phone Holder 1 Light Box 1 Hydrophobic Glass slides 3 Positive Control DNA 5 mL SYBR Gene Dye 5 mL Supplied by User Amount Micropipettes 1 Micropipette tips 200 Lab Coats 2 Template DNA 3.2 μL Smart Phone(with camera) 1 PCR Protocol DNA Measurement Protocol Research and Development An anencephalactic fetus Background on Disease Markers The two diseases we decided to analyze are Alzheimer's and Anencephaly. Alzheimer's disease is a form of dementia that affects the brain by gradually deteriorating an individual's brain function, leading to memory loss and impairing cognitive skills. The gene responsible for Alzheimer's is labeled PSEN1 and a mutation in this gene can cause toxic protein to build up in the brain leading to symptoms described above. The gene is found on chromosome 14 and the reference number for this gene is rs63751320. The allele sequence is GCTCATCTTGGCTGTGATTTCAGTAT[A/C]TGGTAAAACCCAAGACTGATAATTT. For more information on this gene can be found on this link. [1] Anencephaly is a relatively common neural tube defect that occurs during early fetal development; it causes parts of the brain and skull to not develop and results in fetal mortality in almost all cases. Although most occurrences of anencephaly are attributed to environmental toxins or low folic acid intake during pregnancy [2], but has also been affiliated with Meckel syndrome, a rare genetic disorder that affects the RPGRIP1L gene [3]. The most severe phenotypes of Meckel syndrome are present with complete inactivation of the RPGRIP1L gene. The SNP associated with Meckel syndrome is rs121918202, the gene sequence for this SNP is ATGTAATTTTATTTTCATTTTAGCTG[C/T]AGGATAGAATTAATGATTTAGAAAA Forward Primer: TAATATGTAATTTTATTTTCATTTTAGCTG Reverse Primer: GTTAATTTTCTAAATCATTAATTCTATCCT Primer Design Alzheimer- Alleles: [A/C] Forward Primer:5'CGTGGCTCATCTTGGCTGTGATTT3' Reverse Primer:3'CCCGACACTAACCTCGTCTAACAC5' The disease allele, in this case C, will give a PCR product because the PCR detects the specific allele difference or mutation and gives a positive reading. Since the PCR detects the specific allele mutation, a non-disease allele will not produce a product. Illustration