BME103:W930 Group8 l2

BME 103 Fall 2012	Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help
OUR TEAM Name: James Beauchamp Open PCR Machine Engineer Name: Paige Stokes Protocol Planner Name: David Barclay R&D Specialist(s) Name: Student Role(s) Name: Student Role(s) LAB 2 WRITE-UP Thermal Cycler Engineering Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski. System Design The Picture above depicts the three major changes made. The PCR block was enlarged to include forty sample slots instead of the old sixteen. Due to the enlarged Block the heated lid was elongated and the LCD screen was moved to the front. To increase the sample size to forty, four rows were added upon the bottom and one column was added on the right. Also labels were added to the rows and columns to help keep the operator organized, thus reducing the chance of making a mistake. To allow for the larger heated lid and block, the LCD screen and pcr board was moved to the front Key Features Heated Lid/PCR Block: In the new design the Pcr Block is enlarged to include forty sample slots, this will stretch across the majority of the top of the machine. To ensure accuracy alphabetical labels have been added to the rows and numerical labels have been added to the columns; Doing this allows for the operator to keep track of separate samples by simply assigning them a particular row and column. Along with the larger PCR block the mounting plate and thermal pads have been adjusted to fit the new block. To help the machine accurately keep the temperature of the heated lid at the correct temperature another layer of insulation will be added around the mounting plate. This will help the machine reach the exact temperature needed more accurately. Heat Sink/Fan: The heat sink and fan will remain the same, but due to the larger PCR block the heat sink and fan will be moved forward slightly(towards the LCD Screen). This simple change will allow for a more even distribution of heat across the forty sample slots by allowing the heat to spread evenly across the new block. LCD Screen: In the new design the LCD Screen will be moved onto the front of the Open PCR machine. This is due to the enlarged Heated lid and block on the top. To move the LCD Screen onto the front of the machine a new hole will be required. Along with moving the LCD Screen to the front the pcr board will also move to the front, behind the LCD Screen just as it was before. Instructions Protocols Materials Supplied in Kit Amount 10 μM Forward Primer 2.5 μL 10 μM Reverse Primer 2.5 μL GoTaq master mix 119.5 μL dH2O 119.5 μL Total Volume 250 μL Supplied by User Amount DNA Sample (20ng) .5 μL PCR Protocol Plug PCR machine into the computer. Open the 'OpenPCR' program on the computer. Label the tubes. This information should include the patient number (1 or 2) as well as the replication number. The positive and negative control should also be labeled. Prepare the experiment by loading the reactants into the PCR tubes. This will consist of the patients DNA, along with the master mix components. As each tube is filled, put it into the chamber at the top of the machine. Close the lid of the chamber. Customize the settings in the 'Thermal Cycler' program to include three stages. Stage 1 is one cyle and in it the reactancts will heat up to 95 degrees Celcius for three minutes. During Stage 2, there are 35 cycles. The reactancts will heat to 95 degrees Celsius for 30 seconds, 57 degrees Celsius for 30 seconds, and 72 degrees Celsius for 30 seconds. Press start on the program to begin running the PCR. Collect and record data at the end of the trial. DNA Measurement Protocol Research and Development Background on Disease Markers There are many different SNP's for the Prostate Cancer Gene. This is shown in OMIM database reference number 176807. The sequence for this phenotype is: AGAGCTTGTAGGGAAAGGAAAACGCC[A/G]TCCTTTGAATAACAATTCTGAAATT. The specific disease name for this SNP is sporadic prostate cancer. It is located on the 22nd chromosome with the Gene ID CHEK 2. The allele change is a G to a A in the positions 614 or 743. This change in the allele leads to an argine to histidine protein residues. This leads to an early onset prostate cancer. Primer Design Illustration